Description :
From Genome Similarity Track
Location :
Scaffold_25:115499- 116899
Transcript NameFunction/comments
g13307.t1hypothetical protein

Sequence
1400 bases(100 bases per row)
CCCGTCACCACCGCTAGCCCCTCCACAGACCACCCGAGCTGTCACCAGACTACCACCATACTGCGAGCCGTTCATCACCTGCACAGCTTTCTGAGCGTCG
CAATTATCATTGAATATCACCGAGATCTGCCCCGAAGTCCCATTTAAGTGCAGCTCGTTCACCTTTCCGTGTTTGCTGAAAATCTGCCTCATTTCTTCCT
GGACATCAGTAACTTCATCCGGGTCCTCCAGCTCTTCCGGTGTCAGCATCCCATCCACCTCCACCACACAACCCTCCACCTTGTCTTCAGCACTTTGCAG
CTCCCAAACACAAGTCACCGTCCTCCCCCCGAACACGTTCCTATTGAACGCAGTAAAAGCAGAAACTGCGTCTTTAGCATGCTGAAAAGTGACGACCACA
TCAACATCTTTATCTTCCTCGTCTTGAACAATTGCAACGTTTAGCAGCTCTCCGAAGCGTGAAAAATCGGCTCGAACTTCCTCTCGAACCTCCTCGGCTT
CGTCGTCGTCTTCCAGCTCTTCAGCTGTCACGAGACCGCGGACTCGAATTTTAGAGCAGTTTGACGATTCTCTCTGTTGCAAACTCCCATTTTTGAACTT
GGATTTGCGTTTACGCCGCTTTGGTTTTGCAGGAACTGCTGGTGCTGCAGAATCGACTTTGAGAGCGCTTGGCAGAGGGATTGACGCCTCCTGCTGCTGC
TTTTTGCGTCTTGTGCAAGATTTTTGTGGCGCCGATTGGCTTTCTGGTGAGTTTGCAACGATCGCAGCCTGGATGTAGGAGTCGAGTGTCGGAGGCTGTC
GCTTTGAAGGTGACGCAGTTCCTGCTCGTCGCGACATTTACCGGAAACCGTCACAGAAAATGGTATCAGTACCGGTAATATTAAACATACGTAGTGAGTT
TATCATACTTTATTTTGTGATATAATACACGCAAATAATAGTCCTGGTAAATTACATCCAAATTATTTGTACTCCAGTAAATTACGGGGTTAGTTGAAGT
GTAACGGGCTTGAGGAATGAGCCTCTCGGGCCGACAGCAGACTCTGTTGAGTATCTACGGGGCTGCAAACGACGGGAAGAAGAAGGCCCCCAAGAAACCG
CATCGCCCGCTTTCCAGCTCCTTCAATTTGGCGCTCGTACCTCGAAAGAGCAGCTCTGGTTGTGGTCCACGACGTCCAGCACCTTTTGTCCGACGTGACA
GTGGAGAACGACGAGATGTTGAGCCAGATCAAGTACAAAATGCTATTCACGAGCAGCCAGTTCTACCTCAGTCGACTGTGCAGCCACCGAAAGCTCGTAG
CAACCCCGTGGAGGACGAAAAAGTAACAGGTGAACGGGACCGACCTTCAACGTCCAGGTACACTGTACATAATGTGCTGGTTGGGATCAACACGCTGACG