Description :
From Genome Similarity Track
Location :
Scaffold_1:115488- 151530
Transcript NameFunction/comments
g29.t1hypothetical protein
g30.t1XP_009515398.1 hypothetical protein PHYSODRAFT_321807 [Phytophthora sojae
g31.t1hypothetical protein
g32.t1RAW41886.1 hypothetical protein PC110_g1871 [Phytophthora cactorum
g33.t1hypothetical protein
g34.t1hypothetical protein
g35.t1hypothetical protein
g36.t1hypothetical protein
g37.t1RAW41890.1 hypothetical protein PC110_g1879 [Phytophthora cactorum

Sequence
36042 bases(100 bases per row)
ATCGTCGTGAAAATTCGCCCAAATTTGCTGCATTTTCTGGTCGATGGCTGCGTATGGGTAAGCTGGTCCACTTGAAATCCCATGGAGCTCCTCTGATAAA
TCCTTACCATGGCTCAGTGCATTATCAGATCCAAGGTGCCGATCGCAGATGTCCGTGACTACCATTGCAACGAGTCTGAGGCTGGTGAAACTCGCCTCAA
ACTCCTGGTCGCCGTTGCAGACGGGAACGTGTGGATCGTGACGTTGCCAGGCCAATTTCAGCCTGAAGTGGGGGAGATGACGAGTGAATTGGTGTTAGAG
CGCTCGTTTAATAGTGGGAGTGATGGTGGATGCGTGCAGTGGTTCTGTCAGGTTCCTGGAGTGCAATCGACTGAGCATGTGCCTGCAGGGTCAGGACTGT
CGTCTCTTACGCTGCTGAGAAGCTTAGTGACCCCGACGATGTTGATTGTGAGCACTCTCGGGAAATCAGAGTCGACATTGCAGCGCCACCAGTCGCTGGA
ACTGGACGAGATTGAAGGCGAGCAGTCTACGTGCACATTTTGCTTGAATAGTCGAGATTTGAGCCATAGTGAGATGCTGAAAAAATTGTTCCCGGAAGTG
ATGAACTACGCGGGCATGACAGCTGTACTGCAGGGTGATCTAGATGGTTGTGTGAGGTTCTCTTTGGTTCAGTACCCTTGTGTGAAAGGAGACATCGCGA
AGGCGTCAGTAATTCGCAGTGGTATCCTTCTTCAGCTGGATCAACCAGTTCAGATGATCGTTCCATTCTCGTCTTCTGTGTCACCTACACTGTTGCCGGG
AAACAACGAAGCAGTTCCTTCGTCGCTGGTGTTTAACACACTGTTGGTACTTGGTACTCGAGGGCAACTTGGAATTGTTGACTTAGAACGTGGTAGCCCT
GCTGAGACCCTCCCGGTTTCGGTGAAAAGGCTGGAGATTGGACGTGCAGTGCAATCGTTGACATTTCTGAACAGCTTGGCGGTGTGCATTTATTGCTCAA
GTGGCTCGGCGTTCGTGTGTCGGAGCACCGATCTGCTTGCAAAAGCTCAGCACGCACATGCAGAAGCGAACGGAACGCTAAACGATGGCACTAGAGTCTG
TGGTGGCAAACTGCCTCTTCAACCGGTAAGTGATATCACGAACACAGCCCTGTCCGAACCTATGCTGACGAGGTGTGAAAATGTATAGGGCATCGTGCGA
CTGACAACACACGCGCAGGGGATATCAATTCTCTTTGCGTCGGGGCGCATCACAGCTATCAATGAAGCAGCTCTTCATGAAATGGAAACAGCTATGCTGC
CGCTGCAAAGGCATCCAGGAAATCATGTTTACCCAGGATTGGCCGGTGGAGAACCTCTTCGCGAGTCTTGCGTCCGTAATCTGTTGCAACAGATCGCACA
GATTTCCGATGCATCTGCTACCTTACGCACGCAGTCACAGCTAATGGACCACCAGCTTGATACTCTGCACTCAGCTTTGAAAATGCTGCGGCTCGTGGAT
ACGGCAGGTTAGTGGGCATAATACTGTTGATCGACGACCGATCGCTCGTTAACTTTGTTATGCATCTTTTACAGGTGTGGATTCAGTGATCAAGTGCGAG
TTGAGCGCTTCGATGATAGAAACTAGAACCTTCTCCGGCCAACAGACTGTCAAGTTGGTGTGTTCATTGCGGTTTGTCAATCCCGAAAGTGTCATATCAC
CTAGTAATTGGTAAGTCGCGCTTCAGTTCCACCTTTCAATTGCTAACCATACAAAGCCTCATTTCATATTATCACGGGCTACTTCCGTTTGTGTATTTAG
GTGGCTGTGCTTCTACGTGCGTATTAACCAGCGTGCAGTGACGACGTACTCATTTCCTATGAAGGATGTTTTCGTGCGTGAAGAGCAGAGCGTCATTCTG
AACCCGGACACAGTCGCTGCACAAGATCAGGGTTCTCTGTGGGTATCGTGCTCATTGGTGTTTTGTCCCCCAGAAAGCGGACAGCGAAAGACCAAGCGTA
ACAATACGAGCACTCTAGACTTGAAGACGGCCCAGCGCAACAGCCCGTTGTCATTTGCGATTCCGTTGCTTCAAAGCCGGAGGTTCGTGCTTGCGCAGCT
GAGTCGGCCCATTGAAGGCGATATTCCAGTCAGTCAAGTTGCCATCAACGCTGCTTTCCGTCAAAATCAAGATCCATTCATGCCAGTTAATAGGGCAGAC
AGCTCAAGCAAAACAGACAAAGCCTCATCGTCTGCACTTTGGGGCGGTGTCCAGTGGTGGGCTGCGCTGGCTGACTATGCCCAAAGCAACCCGTCGTTTG
CAGCTTTGTGGTCGAAAGTTGCGCCTCCAGAGGCGACGACTTTAGCGCTGTCCCCACCTTCGCGATTTGTGATATCTATCTCTTCGTTTTTTACTGGTGA
AGGCGATGATGAGGATGGTGAGGATGAAGATGAAGATTTTGAAAAAGTTCGTGTCGAACGGATGGTGTCTTTCTTACGGCAGCTCTTGGATATGCCTGTG
AATGAGATTCCACGTTTACGTCGTAACTGCAGAACCCAGCATGGAAAGCTTTGGACAGTGTTGCGAACCTTTTCAGGGAGTCTGATACTGCTGCGTTTTA
CGCCATCGGAAGACCAGTCACACTCAGTTGATCTTACTATCCAATGCTCTGATGTGGCTGACCTCTCAGCAGTACGTATTCCCATGTGGTAGAAGTTTCA
AAACCAGGTAAGCTGTGAAACTAATAGCTATTGTACCATGATACTGTGCAGATGCGAGCTCTTGTGCTGGAAGCTATCAGCAAATGGAGCGATGGAACCT
CACGAACTGTTAATGAAGAAGACCGCTCTCAAGAACTCGCATTGGACATTGGCGAAATGCTAGAGCCCATAGCCGCTCTTGAAAGTCTTTTGGAGGTCTG
TTGACCAATGCACGATATAGTTGTGTCGCAGATTTGTTAACCTTGCGCGTTTGTGAACTCGTTTTGCAGGATCTGGCGCAAAAGACGATCAAAAGTATAG
AAGACCCTCAGTCCTCTGTTTGCACTGATGAAGTACTCCAGGCGCTTTCACAGCTTGCGCACCTGGAAACTCAAACGCTTACACTCTACTGGAAGACTCG
GATGCGTCTTAACCGGACCATAATGTAGTCCGTGGTCGCGCTCATGTTGTTAAAAAACTAGAACGACAACTTCATTTTAAAAGAGGTAAACCGCAGATAA
ATCAACGATGGAGATAAGTAGCCACGTCACCAACGGAAAGTACCAAGCTACCTCAAAGCACTTTCGACTGATGACTTGCTAAAGCTCTTCAGTGGGGAGA
TGCTGGTCACGCAAGGATGCCTTCTCGGATGGCGACGAAACAGAGTAGAGGCGCTACATACAGACCATTTTCACAATAGTTAGCAACTCAACACTGTCGC
TAGATATTGTACTTAGAAGTACTTCGAAGTAGCGGGGTGCTCGGGTCGGCCACAGCGTGTAAATCAGAGCCAGATAGATAAAGCAATGGACTGAGGTTGT
CATGATTGCCACAGTTTTCTCACGCACCCACGGCGACAAGAATGATGCGATAAGCACGATGATAGGCAAGGCTACGAAAAAGACCGAGAATAAGCAGCAC
ATCTGAAGCAGGGATTAGTACAGCACTTTGGTCGGGCAGTCAATAGCACTTGTCATCCTTACTCGCAGGAAGAAACGCCGCTTTGTTGAGGCCTTCTCGT
ACGAGCGTGTCTCCAGGATGGTGTTGATAAACCACCCGAGCACACACATCTGCAAAACGCAGATGCCAAGACCTGGCCATGAGTCGTAGATGTACAGCGT
CGACGCGGGGTCGAGCCATATAAGATACCACATCGCCATGGACAAATACAACGCGAGGATCGCGAGCATGACACACGAGAGCTTGATCTGGCCGTCCAGC
GCGACGCTACTAATAGTCCATCCTTTCGCAATCAGCATAGCCAGTAGCAACGTGCCTACGCGAACGAACACCTCCGCGATCTTGGCCGCATACTTAAAGA
ACGGCACTCCGTACCCGTTGAACTGGTACGTTGTGAAATGGATAAAGAGCAGTGCGTTGCACAGGAAGAAAAGGAGCACCACAAGCGTGAGAATCCGCGT
AATCGGGTGGAACGACTCGCTCCTCATGCCCCGCACAGCCACCATTTGAGCCGCAGCTGCAGCTCCCGCCACTGCGGTCATGACTGCGTAGATCGTGGGC
ATTCCTTGCTGCTGCACGGGGAGCTCACTCCCATCCCCCTGCGTCATGTGGATATTATACCACGATGAGAAGTAGTATTTACGGAAGTTGGTCTCCGTGA
TTTCTGCGAAGGAAGGTTTGTACTTGTCCCCACCGGGCACGCAGCGCGCCAGCGCTACGTACCAGAACCTCGGGCGTAGATGTTCATGGATGTCCACACT
GAAGGAGAACGGAGTCACGTGATGACTGGTGGTGGCAGTGACGTTGTAGACGCCCTTGGTGTGCTTGGCAGAGACTTTGCAGTAGCAGTCGCAGTCGCTG
TCAGTCATGACGAAGTTCCAGAAGAGCACCTCGTCGTCGTAGATGGCGACTTGGAGCCCGGTCACGTCCGTCTCGATCTCACCTGCGATGCGCTACAACA
ACAGGGACGTCAGCGTCAGTCTATTGCTTGTAGGTTACGAAGTTATCTAGGCTTGGGTCGTACTCCAGCGACGTCATCGAGTGTGGGTGCCCAGGAGAAA
CAGAACTTGCCGATGTACTGGAACTGCCGCCCGACCGTGTAACCCGCGTAGATGCTGCCGCGGGCCACGGACAGCAGCGCCGCCAGACTCAGCAGCAGCA
GCTCGAGCGACTGCATGCCGAGGAATTGTATCGCTATCTTCTGCGGAGACCAAGCGTCGAATGGCGATCTTCGGACAACTTCAACACCATTTGATTGGCT
AAGAATCTTCTGACTAGTTTTCTGCCTGGAGTTTTGAAGCCATTTTCGGTAATACATATGCGTGCTACTCGACGAGTTTTCTTATGCGCGTTGGGCGTAC
ACGTAGCGTGCGTGCTTCGAGTTGCGAGTCTCGGTGCCACACGAGCATTTGCAGTGCTCTCTGCGTGACGTCCTGCCAGCGCCGCGTCCACGACTCGTGA
ATCACGAGGGCCAAACAAGAAGCTGGTCGCCGATCGCCAGGTACAGCGCCGTGGGTACGCTCAGGGTGGCTAGCAACGAGGGCTGGTCTGAAGGCCAGCC
GAATTGCTGTTTACTGGCCACCGTTTCCGCCGCTGTTGGGTCAACTCGCGAGTGGGATGTCATCCAGTCAAGAGCTTAGCCCGACGACGACGATGACGAG
GGGCTTGACCGTTGTCCATGTCTCCTCACAGCAGCAGCAGCCGCACCACTGAGTGAGATACACTCAGTAACGGATACGGTGCCAGCTCCTTTCGAGCAAG
CTCTGTTCGGCCCAGGCCACAACATCCCATGCAGAGGCTTCCCGGAACGGAAAAAAGCTGCAATCGAGCACGGGCTCTCAGACCCAGTGGAAATATCCAT
CCAGGTTCAACTTGCGGGTAGATCTGGGTTCACTACATGTATATAACTCCATGTATCTGGTAAGCTTAGAGTACATTGTAGGCAACAAGCGCAAATGCAG
GCATTGCCGTCCTTGGTGGCGTGTGGCAATCCGCTTTCGTCTCGTCGTCGGTCTCCGACGTCTGTCCCCGCAGCTGTTCCCCCACTTGCTTTTTGTATGC
CGAGGCGTAAAGGGTTGTGTGTGCGCGGCAAGTACTTGACCATCACCTCGCTCAAAACAAGGAGTCAGTTTTTCAACGGTTCAGAGCGGCAAGGGCGTCC
CGTCGCCGCCTTGTGTATCATCGCGCTCGAGTGCCTAGTGCGCGTTGCATTGCCCAGAAGCCTCTCTATTGCTCACTCGCGAGGGGTACGGAGACCGTCC
AGCCAGGCCATCGCAGCCAGTTCCAGGCTTGGACCCCCGCCCACAGGCTCCCGCTCACTTGATTCAGGTCACAGGGGACTCGGAACGCGTCCAACATGAC
GGTGCGCCGCACGGAGGAGCTGCAGGAGTGGATCTGCAGCATCACGGCCACGTCCAACGACCATGGCGAGCACCTGTCGGTCATGCTGCGCGACGGCCAG
TTGCTGTGTCTGCTGGCCAACGGCGTGGACCCGGCGGCCAACCTCAAGGTCAACAAGCTCAACACGGTCTTCCACTCCAAGGCCAACATCCGCCTCTTCC
TCGAGTGGTGCAGGAAGCAGGGGCTCAACGACGGAGAGATTTTCCAGGCCGACGACCTGCTGGATGCAGGCTCCGACTTTGCCACGGTGCTGGGCACGCT
CTCCATCCTGTTCGACAGGTTCGGCACAATTGGGTACACGGGCGAGTACGAGGAGGACCCCGTGTCCGATGCAGAGTCCATGACGTCCACAGGAAGCTCG
CAGGGCACATCGCCGGTTAAAAAGACGGGCAGCAACAACAAACTCACCAACTTCATGAAGGGAGGATTCCTATCCAGGAAGAAAAAGGCGGCGTCCGGGA
AGAAGATAGTGGACAAGTCGCCGCAGGGAACACCCCCGGCTACTCCTCCACCGCTTTCGCCGCAACTTGGCGGCGGGATGATGTCTCCGCAGGGATCACC
GCCTCCGACGACCCCGTTAGAGCCGCCCCCGAGCCAGCAGCAAAAGGACTCGAGGAGTAACAGCGGGGGCGCCAACTCGAACCGTCTCAACGCCTTCTTG
AGCCAAGTGCCGGCTTCGCACTCGCCGTTGACGCACGCTGAGCGTCCTTCAGGCCCGCCCAAGAAGGCCAATTCGTCAAGAAAGCCGCCGGCACCGCAGC
CGAAGCCTCAACCGACGGTGAGGAGGCCAGTGTCGCCCAAGCAGCCTCCCAAGTCGCAACCGACTGGTGGCAACGCCCGCAACAAGTTCGCGGCCTTCAT
GCAGTCCAACCCGCCTCCTGTTGAGACGACACCTGCTTCGGGTCCTTATCCGGGCTCGAAGGGTTCCAAGATGTCGGTCTCTCCCACTGCGGGTAATAAG
CCAGCACCTTCCCCTCCGAAGTCTGCCCCTGTCCGAGGTCACGGCACCGCAAGTGATCAGTTCGCGCAGCGCAAGGCTGCCTTCGCTGGTGGCAACAGCA
GCCCGAAGCCTCCCTCACCTCCGTCGAAACCTTCAGTTAGTACCGGTGGTACCAACAAACTCAGCAGCTTCATGCAGAAGCAACCGTCCGCATCACCCGG
CTCGTCGACGAAACCTCGGTCGCAGAGCAAGCTGGCTGCTTTCCTTGTATCGACAAACTCAATTCCTTCCATTCCGTCGGCCACCCCAGCGAAACCGACG
CTTGCTTCGTTTAACCAAGCGAAGAACTCATCGGCTGGCGGACGGGCAGCTCCTAAGTCAGCGTACAATGCCCCAGCACAAGTGGCATCGACACCAACGG
CATTTAAGCCACGCCACATGATCGAACGTTCTACAGGTCGCGGCAACTACATTCGCAAGCGTCAAACGTACTGGGTGCCCCCTAAGCGTCGTCGCAAAAG
CAACTTCAGCTTGGAGAAGAAGCGCAAGGCTTTCATGAAGGAGCAGCTGGAGATTAAAGAAGAGCAACTTCGTCAACAGGCGGCAGGTGCTGGAAATAAG
CAGAACCTAATTGTCCCGGGCGTGCAATGCTACATTCCTGACAAGGAGGAGGTGTGGTTGCTTTCCGAAATTGTGGATTACAATGAGCGACGAAAGGAGG
TGACTATCACAGCGTTCTTGGATTCGGGCGATTCGGAGCAGCGTGTTGTAGATCTCAAGAATCCGGACATCATTCGTGCCGTTGCCGGACCGACGGCGAC
TGAAGTGGAATCTCTTCCAATTGCCATTCTCCACGACAACCCGGAGGGCGTTGAGGATATGCGTTTGCTTCGCTACTTGAACGAGCCGTCAATCCTATTC
AATTTGAAGCAGCGCTTCGCTGCCTCAAAGCCCTACACGTACACTAACGACATCGTGATTGCTCTGAACCCGTACAAGTGGATCGAGAACCTTTATGGCG
ATCACCTGCATGAGGAGTATCTGCGAAAGCCGCGTGACTCACTGTCTCCTCACGTGTACTCAACCTCAACAGCGGCGTACAAGCACATGAAAACCAATGA
GATGAACCAGAGTATTCTTGTGAGTGGTGAGTCGGGTGCTGGTAAGACGGAAACGACGAAAATTGTGATGAACCACCTGGCTAGTGTGGCTGGTGGTCGC
AAGGACAAGACCATTGCTAAAGTCATCGATGTCAACCCGCTTCTCGAGTCTTTCGGTAATGCGAAGACGACACGTAACGACAACAGTTCGCGTTTCGGTA
AGTTTACGCAGCTGCAGTTCGATAACCGTGGTAAGCTGATCGGCGCGAAATGCGAGACCTATTTGCTGGAGAAGTCGCGTGTGGTGTCAATTGCAGAGGG
CGAGCGCAATTACCACATTTTCTACCAGCTTCTTGCGGGTCTTTCTAGCCGCGAGCTAAAGGACTTTGGACTGGACCCTGATTGCAAGTACCAGTACGCG
GGTTCGCTTGCCGAGATGCAGATTCCTGGTCTGGACGACAGTAAGTGGTTTGCTGGCACGCAAAAGTCGCTGTCGATTATTGGTCTCGACGCCCGCGCGC
AGAAGACGCTTTTCAAGCTTTTGGCTGGTGTGTTGCTGCTGGGTGAGGTGACGTTCGACAAGAGTGGAGAGGAGGGCTCAAGTATTTCGAGCGGTTCTGC
TCTGTCGCAGGTTGCCAAGATGTTCGGTCTTCCCACGACGAGAATCGAGGAAGCGCTGTGCAACCGCACGGTCATCACGCGCAATGATAGCGTGACGGTG
CCGCTTGCTCCTGTGGAAGCGGCGGAGAACCGCGATGCCTTGGCTAAGACCATCTACTCGAAGATGTTCGACTGGATGGTGGTGAAGATCAACGCTGCCA
TCAGCACGGACGAGAGTCGTATCAGCGGTCAGATCGGTGTGCTGGATATCTTTGGTTTCGAGGACTTTGTGCACAACGGCTTCGAGCAGTTCTGCATTAA
CTACGCGAACGAGAAGCTGCAGCAGAAGTTCACTACGGATGTGTTCAAGACTGTCGAGGACGAGTACATCCGTGAAGGGTTGCAGTGGGATCACATTCAG
TACCAGGACAACCAAGGCATTGTGGAGGTGATCGAGGGTAAGATGGGTATTATCGCCCTGATGAACGATCACCTGCGTCAGCCGCGTGACACGGAAGAGG
CCCTGGTCAACAAGATCCGCACGAATCACCAGACGAAGAAGGACGGCAACGCAAACGAAAGTATCGACTTCCCCAAGGTGAAGCGCACGCAGTTTATCGT
CAACCACTACGCCGGCCCCGTCACGTACGAGACGGTGGGTTTCATGGAGAAGCACCGGGATACGTTGCAGAAGGACTTGCTCGACCTGATCCAGCTAAGC
AGCGTCTCGCTGCTGCCGGAGCTCTTTGAGGACAGCGAGGCTGTGACGGAAGGCGGAAGCGGACGCGGCAAGAAGGGCCCAAAGAGTTTGGGCTCTCAGT
TCAAGACGTCGCTGGCCCAGCTGATGGATAACATCAAGACTACCAACACGCACTACGTGCGTTGCATCAAGCCGAACTCGAACAAGAGTCCGACGGAATT
CAACAAGCGTATGATCGTGGAGCAGTTGCGTTCGGCCGGTGTGATCGAAGCCATTCGTATCACACGCTCCGGGTACCCGAGTCGTCTGACTCCGAAGGAG
CTGGCCACGCGCTACGCTATCATGTTCCCGCCATCGATGCACAGCAAGGATGTTCGCCGCACGTGCAGCGTCTTCATGACGTCGATCGGGCGCAAGTCGC
CGCTGGAGTACCAAATGGGTAAGACGCTGATCTACTTCAAGAACGGTGTGATGGAAGAGCTAGAGGCCATGAAGTCCGACTTCATGTACTACGAGGCGCG
CACCATCCAGCGCATTGTGCTGGGCTTCCTTGAGCGCCGTCGCCTGCGCAACAAAACCCGCGCTGCCGTCGTGCTGCAGTCGTACGCGCGTATGTCGCTG
GACTACAAGGAGTATCACTTCCAGCTCCGTGCTATCATCAAGATTCAGCGTCGCTGGAGGAGGTACAAGACGGGTCAGGTTCCGGAGCCCGAATACAATG
GTGAGGACTACGACGGCGGTCAGTGGGTTGACGAGATTGATGACCTTGACGACTCGGACGCCGACGAGGGCTTCGGCGACGACCCGGCTTCGGTCCGTGC
AGGCCGCGGCCGATCGATCGCGGACCGGATGGAGTCGTTCAAGGTCGCGCACTCGGGTCGCCGCGGCAGCGTGAAGCGCCTGAACGAGCTGTCGGCCCGC
GCCAAGAGCTTCATGAAGCCGCGCAGTGGCAGCGGCAGCACCTCGAGCTCGAGCGGCATCTCGCTGGAGGATGAGAACTCGATGCTGAAGATCGAGAACC
GCAACCTGAAGTACGACCTGGAGCTGATGCGAGAGCAATGCATCGAGCTGCAGGCCATCATCCTCGAGATCAACAAGAGCCGCAAGAGGTAGAGGGGGTG
GTGGTGTGTGGCGTCGCGTGCGGCTCTATCTTTGCGACGTTCCGGGCCAACAAACCACTTTTTAACTAAACGCCTCGAGGCGTATATCTGTAGCGAAAGG
CATGACAATTTTTCTCTTTCAACATGTGAAGACGTTCAGTACTTTAAGCCCAAGGTGTTCATTCGCGTCTCGCATCGCAAGGTATAGCATTGATGGAGTT
GACTCGCGGGAGAGGACATCGTTCTCTTCAGTATATCGGCAGCCAGATGGGTTCGCTGTGAGTCACGGCGACATGAGACCTTTGAGTGGCTTCGGGCTTC
ATCCCCATCGGAGTTCTGTGCGCGCTTTGCCGAAGGGTGGCTATAAGGCGGAGTTTTTCGAAGCGAGAGATCACCGACGCCAAGAACGGCATTGCCGAGA
AGGCAGCGGAGATGGCATTACTCATGCCCGACATCAACCTCCGTCGAGCCAAACACCACCTCGAGGTTTGGTCCGTCGGTGACCATTTTTCAAGTTCCGA
GTCTGACATGTTCCTTTCTTTCGTGACGTTCTTATTGTCTCCCCTGTAGCGCTACTGGCGCCAATTGCTTGGCGGTGACCGGCCCGGGGAGCGCAGGCGC
TTGATCTTCCGGTCCAAGTCCGTTGCACGCGCGAAAGCCGCCCAAGCTTTACCGGAACCTGCCAACCCCACCGCTACCGGAATTAATTCCGTCGAGGTAG
CGCCATCGACACAAGATCTAGAGCGAGGTCTGAAAATGGAGGACCCCACTGCTGACGTCGTCAAGGGTGTCGGCGACCCCGATCAAGTGCCCGACGTCGA
ACTTGATTGTGGATCTCCATCAGTGGTGAACACTGCGAGCAGCAATCAGGAGACGGAGAGTAATGTTGTTGGCGACATTCGCGAGAAGAGTGAGGAGCCC
CACCTCCACCTGAATCAAGATCATGTCGTCGGAGATTCTACTGCAGTCGACAACGAGCTGCAATCCGTCCCTAGCACTGTGGTTTCCGACGACAGTTGGA
AGTCGGAAGCGGAGCAACCACCGTCTTCCACAAGCACCACTGGGACGTTTTTGTCCGTGGACTCTGCATTCGCTGTGCGATCCGCTGAAAGCACAACCGT
TTGTCTCGGAAAACCACCACTGCCTCGTTCCTCACCAGAAGACATGCCGCAGCCGAAGTACGCGTCACTGACTCAAGGTGAGTATTGATGAGTTTTTCAG
CAGTGGTTGGATGACTACAACTCACGCATTATTATCTTGCTATGCGGACAGGTCCAACGTTAGGCTCGATATTGCAGCGCGTCCGCCTCAACGACGGTGA
CGTGAGCGAGCTGGATTTCTCGACTCTCGCGCAGCGCAACAAGCGTCTGGAGTCCGAAGGGTGCGCTCTTGTGGCACGCTCTCTATCAACCAACCACACG
GTCCGCAAGCTTGTAATTCGCGACCACGCCATCGGAGACGATGGTGCTATCGCTCTCTCCAAAATGCTGTGCAACAACACGACCTTGGAGCACTTGAACC
TGTACGGCAACGAGATTGGCGACCGTGGGGTGGAAGCGATAGCGCAGGCTCTATACGGACACGACTCGTTGACGCACTTGTGCTTGAACAGCAACCGGAT
AACTGACCGAGGTGCTGAGGCATTGGCTCAGGCTATCCGTTGCAACTGCACGCTCAAGTCTCTTGAACTCGTGGGCAACCGAATCACTCGAGTGGGAGCC
AAAGCGCTGATCGATGCAGTAGATGTGAGCATTCATCTTGAGACAGTGAATCTGGAGGAGAACATTGTGCCATCATTCGTTGCAAGCCAGCTAGCTGCGG
CATTGGCACGCAACCGTTCCGAGTCGTTGATGCTTGAATCGCACGCTGCGGAGAAGCAGGCTGTGAAAATTGTGCGGAGGGCTAGCGGGTTGGGCCCCCT
CAGTGACGATGAGTCTGACAACGAGACGGAGGAGAAGGAGGACGACGACTGGGAGGACGATTGGGAGGATGACGACGGCGACAGCGTGTCCAGTGGCTTC
TTGAGTTGCTCGGGCGTCACCGACATTCCGCTAAGCAGCAGCGGTCTATGGATCTGAGAGATCGGCGACTAGATCGGCCTACGTTCGGAGTGTGTACATC
GGCAAGAAGTGTGAGTGAAAGCACGAATATAAACTCAACTTGTAGAGGAACCCTGGTATGAATGATGTAAGCTGCGTCTGCAAAAACTACTTGATCAACA
GAAGAAGTTGGCTGTCGTACCACCTTCGTCCTCTGCCGGTACTTCATGGCACTTGAGGTCGGCCAACTTCACGTCCACGTTGTCAATCCAACATCTGTGT
GACTGCACCTCGACGGACGCATTCGCAATGGAAGCTGGCATGCTGTAAGAACCCCACATCTCACGATAAATATCCTTGAACTGTTTGTTCAGCTCCCAGT
CGATCTGATATTGTCTTGAAAGCGCATCGTAGAGCCCAAGCTGCGTCAGTGATTCGTCACACCACTCATTCTTCACTGCAGGCTCCTTGCCAAGAGGCGA
AAAAAGGTCTTGGACGCGGATGGTTTGCTGTGCTTCTGGTTGGTACCTCGTGGGGGTAAAAGTAGGGGAGGTGTTAAGATTCACAGCACCATCAAGCCTT
TGCCAGCACGCCGATGGTGGAGAGACGACAATGGACTCTTCAAAAGGTAGTTTTGGACTCTGCCACGCACGCGGACTAACACTCGTTCCAACGAACAGCT
CTTCGTGATTTGAGTTACCATTCCACTGCAACGTCTTGGGATGACTAGTTGTAAGCAGCACGCTCAGGTCCGTAAAGATGTCGTAGTTGAACCGGATGTG
CTTTCGTTGATAGCCCTTGCCAGTAGAATCGAGTGGTGACTCAAGCGACTTGTCTGCCGAGGCTGAGGTGAGGATCAAATTGCAACCTTCCAACACCGAC
ACCACGTCATACATGCGGCGTTGCACATCACTGTACGGAGACTCGTTTCGCGCCGAACCCGGTACCGAGGCACCGATAAACTTCTTCGCCTCAATCAGCC
GATCACTCATGTCGGGTAGCGCCACTAGGACCTGGTAGTCTCGCTGAAACAACAACGCGAGGAAGCAGGCCGTCGCAGTTACTAGACACGGCCAATTTTC
AAGTGATGCCTGGTCCTCGAAAGCCTTGACGAGAAAACTATCCTCCTCCACGGCAGTGGCCACTCTCGAACTGCAAGACTGGCGAAAATTCAGCATGACT
TGTGCCGAGTTGCTCTTCATCTCTGCTAGGTGCTGGATCATTGCGGCCTTCCCGTAGTACAAGAAGTAGCCGCCTCTGGTCCTCCTCCTAACCTCACCCC
ACCTCGCGCGCTTGATCACTCCAACCCCTGCAGGCGCCGCATCGTATCAATGCTCAAACCAGCAGGGACGTACAAATAGCATACCTTCCAGTACGTGGAG
CACGTCGTAGATCCTTCTCTTCCTCGGCACTACGCAGCGTTCATCAGAGTCGAAACCACCACGCACCAAGAACGACGGAGCACACGCGCAATACCCTTCA
TTCTGTAGATTTCACTCGCGGGAACAAAGATCGGGAAGACCGGAACTGCGGCTAAGCCTTGCAGCTCCTCGTGCTCCTTGAAAAACTGTAACGTGGTGCG
CGTTCTGCCAGAGCAAGTCACAGTTTAGAGCCTTCCTCGTTGCAGTCGCCAGCTCTGGCGTCGTACATTTCCCCCAGACTCTTGGCAGCCGCGAATCGTT
CCTGGATGTTGCTCCAAGTCGCTGTTGGAAGGCCGTTCGGGTGTCGCGCTGTGCTGCTCGGCACGGGGCTGACGTGACGCGAGTGATGCTGGCGTTTGCG
CCGCTTCACTGGTCGCTTGGGAGCGTGCTCCGCCTTGACGGTCGCCACGGGGGCGGCGTCCTTCGCGGAGCTGAAGCGCAGTTTGCGTCGGTGGGCGCGC
CGAGTCTTCATCGATTTGCTCTTGAGCCGGCAAATTCGAAAGTGAGGATGGTATCCGCACTTGACGCGACCTTCACTCCGATCGAGTTCAACATCTATTC
GACCAGCACGATTTGGAACAGGGAATGGCTATTAAAATGGATACATTCACTTAATGTATTTTATCGTAGTGGTTGATTAGCCAAGTTGAAGTGGGCGACA
GGGGCAACTTTGAGTCAGGTGCAGCTGGTGAAAGGCAACTTCTGCATGTGTCATTGTGTATTCTAAACCTGGCCTTCGAGGTTGTCATTGCACGCGTGTG
AACAGCTCCTTCTCTCATCGATTCTTGTATTAATACTTGCGACTCCAAGAGAGTCAGTCAATGCTTGTAGCTTGACACTCTCGCATAAATAGCAGAGCCG
CCCGCTATTTATGCGCTCAGTCGTTGAGGCACCGCGAAACCCCTTCCTCTGCATCTCATGATGGTCCGCCCGCTATTCACGGCCGTCGGCCGTTAGTGTG
CACAACTCCTGCCTCCACTTTGCCCAGTTCCATCAGCACTCGGCACTCTCTCGAACCTCCTCCTTTTCTCTGGTAGTGGCTGGAGCTCCATGGGTGAAGG
AGCTGCGGCACACGCCGGTGGCGAGTTCCGCATCGTGCACCTCAACGATGCAACACGCAATACGGAAGCCGGCTATTGCAACAACTTCATCGTCACGTCC
AAGTACACGGTGGCGAGCTTCCTGCCCAAGTTCCTCTTCGAGAGCTTCCGCAAACTCTCCAACCTCTACTTCCTCCTCATCTGTATCCTGCAGTGCATCC
CTGACATCAGTAACACCGGCGGCCAGCCTTCCACCTTACCCCCACTCCTCTTTATCATCACCGTCGATGGCGTGTTTGCTATCCTCGAAGACCACAAGCG
TCACCAAGCTGACAACGTTGCCAACGCGAGTCCGACACTCGTTCTAGACCGTGCATCGAAGAAGTTCACTCCAACTACGTGGGCCGATGTCGTAGTAGGC
GACGTTGTCAAGGTGGTGAATCGAGGACTGGTACCGGCAGATATGCTCGTGCTCGCCGTGAGTGAAATTCCTAATCAGCCTCCGTGTGGAATTTGCTACG
TCGAGACCAAGTCTTTGGATGGAGAGACCAACATGAAAGTCCGATCAGCAATGGAGTGTACTCTTGCAGATATGGGCTCAATTGATAACTTGGTCAAGAT
GAAAGGCACCATCCGCTGCGAACATCCGAACAATGCAATCAACAGTTTCCAGGGTGTGCTGGAGCTTGAAGGAAAGGAGAACGCTTCCATCCCGTACGAA
AGTATCATCCTGCGTGGCTGTATCATCCGAAACACCGACTGGGTGCACGGTATGGTTTTCAACACCGGCAAGGACACGAAGATTATGATGAGCAACTCGG
CGCCTCCGTCTAAGATGAGTTCCATGGACCGGTCGATCAACCGGTACACGGTTGTGTTGCTATCAATTTTGATTGTCTTCAGTGCTGTAGGTGCAACAGG
AGCGGTGGCCTGGAAGGCGAACAACGGTTCTGTGTGGTACTTGGAAATGAACGTGTCCGACAACAGCGCTTTTGTGGATTGGATTGTCATGCTATTCTAC
TATCTGCTACTCATGTACCAGTTCGTGCCAATTTCACTTGCTGTTTCCATGAGCATGGTCAAGTATCTCCAGGCGCAATTTATTCAGTGGGACATCAAGA
TTTACCACCCCGAAACAGACACCCCGACATTAGTGCGCTCCATGTCGCTCAACGAAGAGCTCGGGCAGATTTCGTACATTTTCTCGGACAAAACGGGAAC
ACTCACCTGCAACGTCATGGAGTTCCGGAAGTGCTCCATTGGCGGGGTCTCCTACGGAAACGGAACCACTGAGATCGGGCTAGCGGCACTAAGGCGTGCC
GGCAAACCCCTTCCAGATATGACCGCACAGTCTACGGGGCCCAAGGTTCCTTACGTAAATTTCGATGGTCCCGAGCTGTTTAATGATATGAAGGGGGACT
CAGGCTCCGTCCAACAGGGACGTATTGATGCCTTCTTCACGCATCTTGCAGTTTGTCACACCGTCATCCCAGAGCGGCACGAAAACTCCAAAGAAATCAC
GCTGTCGGCTTCATCTCCTGATGAACAAGCACTCGTTGCGGGTGCAGGTTACTTTGGATATGAGTTCGTAAATCGATCTCCGGGTGTCGCTCATGTCAAA
GTTCGTGGAATAGTACAAAAGTACGAGATGCTGGACGTTCTCGAGTTCAACAGTACGCGAAAGCGTATGAGTACGATTATCCGTCACCCAAATGGACGGA
TCTTCTTGTACTCCAAAGGTGCAGATGTTATCATCTACGGATTACTAGCGAAGGACAAGGAGGACGAATCTACTTCTTCCCAGCTCCAGGAGATCACTCG
GCGCCATATCGACCAATACGCTGAAGACGGACTGCGGACTCTGACGATTGCGGTTCGTGAAATTGAGCGTTCGTATTACGCCGAATGGGCAACAAGGTTC
CACGACGCGCAGAACAACCTAGCGGAAATCGACAAGCGAAAGAAGGACCTCCCAAACGCAATTGACCAATGTATGAACGAGATTGAGTGCGACTTGGAGC
TGCTTGGGGCCACTGCAATCGAGGACAAATTGCAATCTGGTGTTCCTGACGCAATCGCCAACTTGGCGTGTGCGGGCATTAAAATCTGGGTACTCACTGG
TGACAAGGAGGAGACGGCTATCAACATCGGCTTCGCTTGCCAGCTTATAACGAACGACATGAAGCTTTTTATCATCAACTCGAAAATCGCAGCAACTCCC
GAAGTACTTGAGAGCACGCTAAGAGATGAGATTGGAGCCCGCAGTGCAGATGTGACTGTCTACCTCGCTTCGCCTCCCAGTACGAGAGGTGATCTCCGCG
AGTTGGCCCTTGTCATTGATGGTGAGACGTTAATGTTTGCCCTTCGCGGGTCGTGCCGTCCTCTGCTCGCCGAGTTCTCGCAATACTGCAAAGCTGTTAT
CGCTTGCCGTGTATCACCAGCCCAAAAAGCGGAGATGGTTGCTTTGATCAAGGAGTACGTACCTGGAGTTCGTACTCTTGCTATCGGAGACGGAGCGAAC
GATGTTTCAATGATCCAAGAAGCGCACGTCGGTGTGGGAATTTCAGGCCAAGAGGGCATGCAAGCTGTCAACTCCAGTGACTATGCTATCGCGCAATTTC
GCTTTCTGCAGCGCCTGTTGCTTGTGCATGGTCGTTGGAATTACAGGCGAATGGCTCAGCTAGTGTTGTTCATATTCTACAAGAACATCCTCTTCACTGC
TGCTCAATATTGGTACACACTGTTATGCGGGTTCTCGGGACAGAAGTTTTTCTTGGAGAGCGGAACACAGCTGTACAATATCGCCCTGACGGCCATTCCG
ATCGTTGCCTCCTCCATTTTGGACCAAGATGTCAACGACGATGTAGCCATGACATTTCCGAAGCTCTATTTCACGGGACCTCGTGATGAAGACATCAACA
CCAGCACCTTCTCCTTGTGGGTGGTTGGAGCGATCCTGGAGAGTATTATCATCACGTTTATCACAATTCACAGCATGAACAACGCGGGCTTCTCTGGAGG
CAGTCCGTCGATGTGGTTGGAGGGCTTTATCGTCTTTACCCTTGTCGTGACTATCGCCAACTCAAAGTTGTTCATGTTCCAGAACAGTTTCTACTTCTTC
AACTACTTTATCTACATGGGCTCAGTTTTGGTGTGGCTTCTGGTTGCATTGGTGTGCAGCCACGTTGCAATGCTCTCGGACCTCACATGGGAGTTGATGC
TGGAGCAAGCTTTTGGGCTTCCATCCTTCTGGCTGGTCTGTTTGTTCGTCCCCGTGGCAGCGCTCTCGTATGCACATCTACTCAACGGCATCAGGTCGAC
GTTCTTTCCAGAGTACTGGCACCTCGCCAAAGAGACCATCAAGTTCAACCTTGACCGCAAGCTCCTACAGTGGAACGACAATAGCAATGCATCGGTTGCG
GTGCCAGCCCGCCTTCCGCACGCAAATCGAGCCGCCAAGAAGAACGGTTCCGTCATACCGACAGATGGCCGGCCTTCACAGCACAGGACAACATTACAGA
AGGCATATCACGGCTTCGCCTTCTCGAAAGATGGCTACGCTGGTGCCACCGAGACACGGTTGCTCATGAGTCGGAGCTCCATCACAAGTGCAACATGAGT
GCAAGACAGTTAGATCCTAGTCTCGATCCACATTAGTACATAGACATTACCCCTTCATCGGGAGTTCTATGTTGCCATCTCCCCTAAATGTTAGCATTGT
CACTTACTGATGCGAGGGCTGGGGAGGAAGAGGCACCACATTGCCAGCATCGGCGTAGCCGATCCGAGACTGAAACTTCGAGTTATTCGGTGAGAAGAAC
AGCAGCTCGTCGACAGCACGATGTCTTCCCTCAAACGTCGTGGGTGCATCAGCTCGAAAGGCAGCGGCTCGACGAAGGTATAATCTAACGTATCAGTCGC
CTAGTGTTAGAATTCGCCACTGCGCCTTCATCTCCATGCCCAGTAGTGGTTTACCTGGCTGTCGCTGCTTCCAGTCTCATGCAACGTTTCAGCCTCAATG
TACGCCCCTCTCGACGCCAAGACAAACGAGATCGCTGTCGTTTAACCCGTCGGTATCTCTCCACAAAACGATCTCCGTCTGGCTCCGTCGCAGCCACGAG
TCGAAATGCGAGGCGATGAGGACTACAGCGACTCATCCGAGCGACGCCGCGCAGGTTCCTGCCCAGTCGCAGGCTCTTCACGGTTCCGGATATGTGCGCG
TCGCGCTCCAGCTGCTCTTCCCGTCGAATTTCCTCCTGCCTCGCTGCCTCCAAGACTTCTTGTGACGCTGCCACATCTCTATCGTTCGTCTTCTTGGCTG
TAGCCGCATCAACTCGCTTCTTTTTGTTCGTGCGTCGCGCCACCAGCCGCTCGTACCTGTCAGGAGCGCACACAGCATCAGCACAACGATGCAAATGCTA
TAGCAATTCGGTAGCGGCGCATACAGGCGGTTGAAGTCGTCCTCGGCCATTTTGACTATGATATCCTTAAGTACGAAACAAACTTACAGGCAGCCACAGG
TTCATTAATCGACGTCAAGATGCTGCGCGTGTCCGGTCTACTGCGGGGCTTGACGGCGGCACCGCTACGTCCTCGCAGCATCCTCGGAGGCTGCTCGACT
CGCTGCTTCAGTGTGCAAAGCGGCGATGATGACGACGACGATGACGACGATGACGACGATGACGACGCGCTGGAGGAGCTGGACTGGGACGACCTGGACG
AGGACTGGACGCTAGACGACGAGGGCGACGCGGCCTTGGCGGGGCGTCGCAAGGTCGAGGAGCACGTCAAGCAGAAGGTGCGCGTGCGACGCGCGCAGCA
CTCCAAGCGCCGCTTCGTGGACCGCATCCGCGTCAAGGCCACGGGCGGCCACGGAGGCAATGGCTGCGCCAGTTTCTTCGCCGAGTCGGCCATGCGCAAG
CGACCAAATGGCGGACACGGCGGTGCTGGAGGAGACGTCCTGATCGAAGCCTCCGACAAGATGCAGAACTTGGCGAACGCCACGCACCACTTTAGGGGAG
GCGCCGGCACCAACGGCATGGGTACGTGCATGGGATTCATTTGTGTGCTGCAAATACTTTTTCAGGGTACTGACTCTTGCGTGGCTGGCGTCCAGCAAAT
GATTCTGCTGGAAGGAGAGGCAAGCATTGCCACGTCAAGGTGCCGTGTGGTACACTCGTCAAGCGCGTGGAGCGCTACGAGCGCGAACTGGAGAATGGCG
AGTACGAGATTGTGGACCAGATGGAAGTGGTGTGTGATCTAGACGAGCCTGGAGCGACGTTCCTTGCTGCGAAGGGCGGAAAGCCTGGACTGGGTAACCG
CATCCTGGCAGGCAAGACGACCAAATTCGGACGGCTGCGCAAGCACATGCCGGAGAACAAGACGACGGGTCACCCGGGTACCTCGCAATACTACGAGCTG
GAACTCAAGACCATCGCTGATGTGGGTCTTGTAGGCTACCCGAATGCGGGCAAGTCGACGCTGTTGAGCGTTCTCAGCCGTGCGACGCCTGAGATTGCAC
CTTATCCTTTTACGACGCTTCACCCATACGTGGGAATTGTGGAGTTCCCAGACACGTTCCGCTTGAGTGTGGCTGACATCCCTGGACTTATTGACGGTGC
ACACCGCAATGTTGGTCTTGGTCACGATTTCTTGCGCCACATCGAGCGCACAAAGGTGTGTGTGTATCATTGATCTGTCTCCTCTACCTGGGCGATGAGC
TAACCATGGTGTGTGTGCGGTGTTTTTACAGATTTTAATGTATGTGCTTGACACGGCGGGCTCGGAGGGACGTGATCCCCTCGAGGACTTCACTCATCTT
CAAAGAGAGCTGGAGCTGTATGCTCCAGGAATCTCGTCGCGTCCGTCCCTGATAGTTGCCAACAAGATGGATGAGCAAGGTACGGGAGGAACATTTACTG
TGAGTGCTTAGCACCCTCACTCTGACGTTGTTCTGGCATCATGCAGGCGCGGAAGAAAACTTCAACAAGCTGCGCCAGACCACCGATCTAGCTGTACTCC
CTGTCAGGTATAACTGCGCCCGCCTTCATACTTCTCTACTTCTTCAACGGAAATCTAACCATGATTTGTCTTGTTTACACAGTGCGCTCCACAAAGTCGA
CATTGATACGGTAGCACGCACACTCCGCTGGATGATCGAAAGCTACAGCAAGCTCACCAAATCATCATAGAACCAGTGTAAGCCGCGTCAGCAACACGAA
AGGATTTTGACCTTTCTAGCAATTATCGTTACTGGTTTGTGTTTGTTTATAGGTGCAGAGGGTGCCTTACTATTCACATTGCTGGGGTTGAGGAGCAGGT
CCAAGATGAACCGCTATGAAATGCTGGACCGAGTTGGTGACGGCGCTTTCGGGGAAGTGTCGCGTGCGCGTAGCGTCAAGACCCATGAAATAGTCGCTGT
AAAGAAGATCAAGGCGTTGTTCCCCACGTGGGAGGAGTGTCTCCAGCTACGCGAATTGAAGTCGCTGCGCGTGCTTCGCCATGAAAACATCGTGCTTCTA
AAAGAGGTCATTCGAGACAAGGAGGAGCTCTACTTCGTGTTCGAGTACATGCAGACGTCACTTTTTCGGGTCATGCGCAACTTCAAAACTCTCGGAAGCT
CCAGCTCAAGTGGTGCTGGAGGCGATCCAAGCTTAAATTCTGATGCTACCAGTTCATCTCGATCTTCGGTGCCCCCGCATCCATGGTTCTCAGAGGCACA
GATCCGTTCGATGATGTACCAGCTCTTCAGTGGCCTAGCATACATGCACAAGCACGGATTCTTCCATCGCGACATCAAGCCTGAGAACCTGTTGTGTCAC
AATGATACACTCAAGATCGCTGACTTGGGCCAAGCACGCGAAATTCGATCGCGACCGCCGTTTACAGACTACGTGGCTACGCGATGGTACCGCGCGCCAG
AGCTCTTACTGCGCTCAACAACGTACAACAGCCCCGTTGATATGTGGGCCTGCGGATGCATCATGGTCGAGCTGCTGGTTTGTACGCCGCTCTTCCCAGG
GACGTCAGAGGCTGACCAGTTCTACCGCATCTGCAAGGTTTTAGGAACACCGACCAAGGAGACGTGGCCTGAAGGTGCAGCGATGTCTTCTCATATGCAG
ATGCGTTTCCCCAAGTGCTCTCCTGTGTCCTGGACTCGATTTCTACCGCCCGGCACACCATCCACAGCGGTTCAACTTGTCCAAGACCTACTGCAATTTG
ACCCGAGTCGACGTCTCACAGCGGCGCAAGCCCTTCAACACCGCTTTTTCGACCAGCCATTGGCACGGCCAACGCTTGCGGTGCCTACTTTAGTGCTGCA
CGAGGAAGAAGTGCCCGTGTTGCCGCTACGGAGCGACCACAAAACTATAGGAGGCTACTCTAGCTATGCTGGAAGGACAAGTGTGTGCTCGAAAAAGTCG
GAGGAAATTCCGGTATCTGCTGTGGAGCCTGCTAGTCATTGGGCTGGTGGCGGTGCCATGTCATCGCGACGAGAGTGGACAGCCAAAGAGCGATACCAAG
CACACGCACGGCACCAAGAATGGGGCTCTTCGCTTGTCAGTGCTCGTGGCGAGATAGCAGATGCAAAATGCACTGGTTCCATTCAGACCAGCGGTGGTTC
GCTCAGGGTGAAAAAGAGCTCTAGCTACAACACGCTTGTAAATGAAGGCAACAGTGAGAGCACCGGTCTTTATTCGACAAGGAAATGCTCGTCGGAAGAA
AACAGCGACGACGACGAATTACAAGAAGGCAAAAGCGAGAACACCCAACTCCAAGATCTACTCGATGAGATTCTAGGGTAAATGCAACACAAACACTTAT
GTTTGGTGATAAGTTCATCAGGTATATTGGTTGCTGTTCTTATCTCAATCATCGCACATCACACTGCTACACAGGATAGCAAGAGCGCACTTAGAACTTG
AGGGCGTGGGCGCGGTCGTTCTTAGTCAGCGAGAACTTGGCGTTCAGGTAAGCCTTCAGGAACGGCTCGGCGTCGAGCTTCTTGATCAAAGCCGAGTCGA
TGGCCTTCTGGTCCTTCTTGCGCTGCTCCGAGATGACGGGGGCCTGAGAGAAATAACACCAACATGGTCAGTGTCTTATAGGGAGCTTATGTGCCGAAGC
AAGCGATCCCAAGCGCTCATATGATGTGATAAGAAGCTATGGACGTCTAAGACATCCACGCCTCCTACCCAATTCGCCACACAAGAAAGAGCACTGAAAC
CAGAGATAGAGAGAGATCCCAAAGGGTTCGTCAATCTCTTTCTCCAACTGCAGAACAACTTCCTTGCTGGATGTGGACGAACTGTTTGTAGTGGTCTCGA
AAAACCGACCAACGGAACGGCAGGGGATAGCAACAGAGTGAAAACAAGCACTTACGGCGCTCGACTGGGCGAAGAACTGCTCCTCCTTGGTCTTCTTGGC
AGCCTTCTCCTTGGCGAAGTAGGCGTCGTCGATGGCAGGGAGCTCCAGACCCTCAATGTTGACCTTGGTCGACGTGGCGATCACGTACGACTGGTTCACG
CGACGAAGGGGAACACCGTTGACCTTGTAGGGGCCTGAAATACATCAATAATCCCAATCTGATGTCAGCAATTGCGTCCAAAGCAACATCAACTCGCACA
AGGCAGGAGATCTAGAGCCGGCATTCCTCAGGTCTCATAATCTGATGGATCTTTGGCAAAAAGACACCCCTTCTTCATCCACCTAGACCCTCAGCGTTGC
TCCGCATACCCCGAGCCAAAGCACCAATAGCCAGACCTCATACAAGGAAGCTATCGGGATGAGGCGCCGAAGTACGAAGCTTGAGGGTATAAGCGAACGT
AGGAAGGGGACGGCAGAGTGCCTCTCGAAGTGTCAAGTTTGCATCATCGGAATGCCGCTACTTTTGTGCACTCCATTTCTGCCGAAAAGAGAGACTTGCA
ACTCACCCGTCACGAGCAGCAGGCCCGAAGCCAGCTGCTTGAGGAAGACCACGCGCTTGCCACGGAAACGGCCCGACAGCAGGATCAGGACCGAGCCAGG
GGTGATGGACTTGCGCAGCTTGGCGGTCTTGACGCTGTTGCGCTTGGTCTTGGCCGACTGGAGCGGCTTCGGGATGTAGTCGGCAGGGTACCACTTCTTG
GTGGTGGTAGCCTTCTTGGCCACGACCTTCTTGTCGCCGCCCTTCTTGACGACCTTGCCACGGCCGTTCTTCTTCGAGAGGCTGTTGGCCGAGATGGCGT
TGATGCCGCGGGCGAGCACCACGTTCTGCGTCTTGGTAGCGGGCATGGTGATGAATATACCTGAGGAAACAAGCAGAACACTTAGGTCAGGAGGCGTTGA
GGCGTCCAACCCACACACTTGCGTGTCTTACCTGTCTGAAAAGAACTGAGCGGTGCCGGGTGCAGACGACTTGGCGCAGAGCAAACCACAGCCAACCACA
AGTTGGTGTGGCGTACATGCATATGGTACAATGTACCAGGTCAGCACGGTTCAGCGGTTACAATTACCCGCTAACCGGTCTTGCGGTTCGATTACACAAT
GATTCGTAATAAAGTTGCGCTGCTTACGTTGCTGTACGTTTAAGTTGTGCTGCATTAATTTCAAGTTGCGCTTGCTGCAAGTTAACTTTTGCGTTATGTT
TGAAAAGTCGATTCCAAACTCGCAGACTTCAACGCGCTGCACGCTGGACAAGTAGTACCAATGGGCAAACGCAACGGCTGTCGAGCGCTCGCGGTAGCGG
GCCCCGTGGACACTGAAGGCTGCTGCGACAAGAGCGACGGCGGAGAGACGTCAGCGTCCTGTTCCTCCAGCGGTGAGGAGGCCAGCGACACAACCCAGGA
GTCGCCAGACAAGACGTGCGAGACTTCGTGCTGCAGCAAGAAAAAGGAGACGGAGAGCAGAACGGGTTGTGCTGACGGTTGCTGTGGGGGAGAAGGCGAG
GTGGCTGTGGACGCGCAGACAATGAAACCTCCGAGCTGCTGCTCGTCGAAGATTGCAGAGGCTGACTCTTCGGGGGTGGAGAAAAAGGCTGGATGCTTCC
CGTCGGACGCTGCTGGCGAGTCCAGTGGTGCTGGTTGCTGTTCGTCCAAGGCACCGCAAGTATTGACTGAACGCGACGATTGCTGCGCTTCGAAAGAGCC
GAAGAAGTCGAGCTGTCGTTCGTCAAACAAGGAGAAGGCCACTGACGATTCCAGTTGCTGCTCGTCGAACAAGACTGCCGAGATTGCGACCGAGTCTGAT
GATTGTTGTACTACTACGGAGAAGACAAAGGCGTCTGGCTGCTGCTCGTCGAAGCCGTCAAAGACCCCAAGTGACTCTGGTTGCTGTTCGTCGAAGGTTG
CAAATGGCGAGACGGAGGGCAAAGCCAACGGCTCTTGTGCTTCTACGAAAGAGCCGAAGACGTCTGGTTGCTGCTCATCCGATGCGTCTAAGACACGATC
CGATGGTTGCTGCTCGTCGAATGCGAAGGGCCTGTCACTTCCGGAGCGATCTCCCAGCTTCTTGAAACGCTTGGTGCAGTTCCGCAACGATCGTGGGGCT
ACTCTCGAGAAGACCCGGTCAATCTCGGGTAGGAAGAGTAACACGACCGAGTCCTTGGAGAGCCTCCGCCTCAACATCAGTGGCATGACATGCAGCGGCT
GTTGCACGCGTATCGAGAAGTTCATGGCCGGACAGCGTGGTGTTGTGGACGTGAATGTGAGCCTGCTTACGAGTCGGGGCGTCTTTCAATTTGATCCGCA
GCTAGTGACGGCGAAGGCTATCGAAGAGACCGTAGCCACCTTGGGATTTGAACCGAGTGTGCTCTCTGGTGACGACGTCGTGGGAATCGTGTTACACCTT
GGGCAGTCTGAAATCGTGCCACGAGCCAAAACACTGGTTCTTGAGGTCGCTGGTGTCGCTTCGGCTGAAGATGTTAGTGAGCCACCAGCTTCGTCGGGAC
CATCAAGTAAGGCGTTGCTGGTTGAGTACAACCCGGATATCACGGGTGCTCGTAAAATAGTGCGGCACCTCTCGCACGAGCTTGGATTCACCGTTCAAGC
CTCAAGCCCGCGGGCGCCATCGGTCCGCGCAGGAGAGGAAGAAGTGATGCGCTTTACGCGTCTGTTGTTCTGGAGCTGTCTGCTGTCATTGCCGGTGATC
TTCGTCGAGTTTGTGCTACCAGCGTTCTTTTCCTCCGACACTAATCTAGCAGATGCAGCAGTCTGGGGCACCGCGAATCTTTTGAGCATCAGAGACGCTG
TGGAGTTGGCGTGCGCGACCCCAGCGTTGTTCCTTGTGGCATTCCCTATTCACGAAAGTGCTTTCCTTGCGCTGCGCTACGGCGGACGCGTTACTATGGA
CGTCCTCATCTCGCTGAGCGCCTGCACTGCCTACGCGTTTTCTGTTTTTACAGTTGCGACAGAAGCGATCGCAAAGTATCAAGCATCTAATGTTGTAGAG
GTGGATCCTTTGGTGCAAGAGCCCTCATTGCCTCCACAAGAGCAAACACCAGTGAAGACGGAGACTTTTTTTCAAGTCACGGTGCTCCTGATTACTCTCA
TTCTTGTTGGTCGATACATCGAGACGCTGGTGAAGGCGCGTGCTTCAAACAGTGTTGATGCGTTGCTGCGCATGCAGGCAAAAACTGCAATTCTGCTTGA
GGGCGAAGACCAGAAGGAGTTGTACATTGAAGTGGTGCTTGTGGAGCATGGCGACTTGCTGAAAGTGCTTCCCGGTACGCGAGTTCCTACGGACGGTGTG
GTTGTGGGAGGTGCCAGTTCTGTGGATGAGTCGATGGTAACGGGTGAAGCTCGCAAGGTGCCCAAGGAACCCGGCGCGACTGTAATTGGTGGATCCATAA
ACTTGCAAGGTGTCCTGACCATGCGTGTGACGCATACCATTCACGAATCTATGCTGGCGCGAATGGTGCGTCTTGTAGGGGAGGCTCAGGCTTCGCGTGG
TGTGCGCCAAAGTATCGCGGACGCTGTGGCTGCATACTTCACCACGTTCATCATCATTCTGGCCGGATGTATGTTCATGCTTTGGTATTCGCTCGCTAAG
CATGGACACGTGGATACGCAAGGCTGGTCTCCTTTTCCGTTTGCGCTGCGCTTCGCGATCACGGTGCTAGTCATTAGTTGCCCTTGTGCCATCAGTCTCG
CAGTCCCAACTGCAGTGATGGTGGCAACAACAAAAGGCTCGCAGGTCGGTGTACTCTTTAAGGGTGGTCGCGCACTTGAAGCGCTGGAAGAGGTTGATGC
GGTCGTCTTTGATAAGACGGGGACACTCACTACAGCACGCCTTGGGGTTGCTGGTGTATTCTATACTCCACACGATGATTTTGATGGAAACCAGCTCTGG
CGCTTTGTGGCTGCAGCAGAGAGCGGCAGTGAGCACTCCATCGGGAAAGCACTTGTTGCCCATGCTCAGACTCGGCTTCAAGCATCTCAGATCGACGAAG
CACAAGCGTTTGAGGCCATCCCGGGATGTGGTGTGCACTGCACTGTGAATGGTGCTGAGGTACACCTCGGTTCACTCACGTGGCTGAAGCAGCAGAGTTA
CGGTGGCTCAGGCTCTCTGCAGGTCCATGCCGAGTTCATCGAGGCGAATCATCGTTTCCAATCACAAGGGTGCATTGTAGTTTTCTTGGCTGTTAATGGC
AAGTTGCTATCTGCTATCGCACTGCGAGATACTCCACGCCCGGAAGCCAAACGTGTTATCGAGCAGCTAAAGCGCGAGGGCATTCAGCCATGGATTGTAA
CAGGCGACCAGCGTGGAACAGCGATGAGCGTGGCGACGGCGCTAGGCGTGCCCGAAGGCTCTGTGCTAGCTGAAACCCTGCCTCATCAAAAGGTGGACAA
GGTTCGCTTGCTCCAGAGTCTTGGCCTGCGCGTAGCTTTCGTGGGCGACGGTGTGAACGACGCACCAGCTTTAGCCACAGCTGATGTCGGTGTGGCGCTT
GGGGCCGGAACGGATGTTGCCCTCGATGCTGCCGACGTCGTGCTCGTCAAGGACGATCTGCGCGATTTACTGAATGCCCGAGCGCTTTCGTGCGCAACCA
ACAGACGCATTAAGCACAATTTCGCTTGGGGGTTCATGTACAATCTGCTCATGATGCCTGTGGCCTGCGGTGCGCTGTATGGGCCCCTTGGAATTTGGAT
CCCCCCGGCCCTCGCTGGTCTGTCGGAGCTGCTTTCGTCTGTGCCCGTGATCCTATTCTCACTTCTGCTTAACCTTTGGAAGCCACCTTTCGGTGGTAAC
TGGGGCCTGCAACAGGATCATGTGGCAATTGACGTGACCGAGTCGACACCTCTGCTGCGCTGAGACGAAGGACAAGGTAGATATGCATGTACTTGTTCAA
ATTCAACAGGTTTGTTTGATGCATACGCTGAAGTGTAGTTCGTCATCTTTCTGATCTTGCTAAATTGCTGTAGAAGGTTTGATGTACTCGAGGAATGCAG
CTCTGGCATGTGTTCGTGCTGAGCGAGGGTCTGTTGATAGCGTTTTATCGGCACTGCTGCTCCCGGAGACAATAGCATCGAAACGGTGGCGAAGCTGATC
AACTTCTTCGTTGGCAGGTGCTGGTGAGATGTAGCTCTCCGTTTCATTGCCTGCCAGTGAGTCGTGTGCAGCACGCATGCTGCGTGCAACCTTTGCACCA
GAGCCACAAGATGTGTGTGTCGGAGTGGAAGCAACTTTTAGTTGTTCCCCAAGTCGGCAGTCACGCACGAAGGCGTCACGGCGCGCGGTCGCATCCCGCT
CGGCCTGCTCTTCTCTCCGTTCCTGTCGTTGTTTCTGCTCTTCGTCCGGTTCGTCTTCGTCTCGAGCTGAGCGTGGGTCAGGCTTTACTTTCAGTTGGTA
CTTGCGTTGCAGGGCTTTGAGTGAGAGGGCGAGATATACGCATGCTGAAGCACGCATCGGCATCTGCGGGAACTTAGGACGTTCACAACCCAGCGCTAGC
AGTACTTCGTTGAGTGCAGCACCAAGTTTCTGCTCCAATTGACCTGGGTAGCTTTTGGCTAGTGCCACCTGGGGTGGTAACTTGACCGGCAGACTTTGTG
ACGCGTATCGAGAGGGCTCAGCGCAGAATTTACGCCGTGCTTCCTCCGAGACGAAGAAGTAAACTTTTGAGCGGTACGATGCGCGGAAGAAAACACTGCC
GTGACGGAGTGAAGCCCAATCTTTGTCGCCCGAGCCCAACGCGAATGTGACGGGGCAATAGCCTTTCATCTCAGGGAAGTCACAGTCCGGCACGGTGAGC
AGACTCACCAGCGAAGCGTTCACTGGTGCCTTTGCGACAAGAGTTTGTGCCTCGCTTTCTGCGTCTTCTTGCGTTGGCCACGACTCTTCTCCCCGTTCAA
GTGGAGTTTGTTCAGGTAAATACCCAACGAAGCCTTCAGGGTTGTCAACGAACTGCTCAAGGTTTTGCTCGCTTCCAAGCCAGAAACTGCAGCCTCGGAA
GTCGACGCATAGGTCACGGCTTGATTGGCGAGAGTTGTAAAACTTCCCTGCCTGCAGCTCAACAGGGCAGAACGTCTGAAAAATATTGTGTTGGCGCCCC
TGAAGTTCTTCATCCGTGCGCACCACACCTAATGAGCGGGCAGCTCGACCGGATGCCATCGCCCTCGTGTGGTGTGATGCCAACTGCTGTTGCTCTTCGA
GAAATATTTGTGCTTGTGCAGCTACGTTCCAGAGCGAGTTGCTGGAGCTGTCGAGTTGCCGAACGTGGAAACAACCATAGCTTCGCGTCCAAACGCCTAG
CAGCTCTAGACGGTGTTGATGCCATTGTGTAAATGCCACTCGAAGCTCGTTCCTGTCAACGTGAGTCTGGTGATTCTTCCAAACACTCTGGAAGCTGCAC
TCTAAAACGAAGAGCATGTCCGGTTGAATACATTGTGATGAAGCCTCTGTCGAATCCGGATGTGGAAGACTGCGTTGCAGCTTATGGCGCTGCAATAGAT
ACCCGTCAAGAACCCAACCACGTGTCTGGCACTCTGAAGAGCGAAGACGAGCACATATAACCTCATGCGTGACACTTGCATCATTAAGCGGGTCATGCTG
CAAGTTTGTGATCTCCTGCAGCCGATGCCGCAGTGCCGATCCACCCTGACACTGCATCACCCATTCGATTGCGTTTTGAGGAGATACGTAGACCAGTCCA
AGTGCGTTTGCAAGTTCCTGGGAGACACGCGTCTTGCCTGAAAATGGAGCTCCTGCCACACAACATGTCAATTGATGCATTGGTGGAAGACTAGGCTTAT
CCAAGTAGCGTGACGGACAAGCCACGAAAGCACGACGTGCCTCGCGTGACCGTGGAAAGTAAAGCTGGTTTCGATGCACTACAGCTTTCACAGAGGCAAC
CGATAAGGAATCAGTACGTCCTGTCACGGGACAGGAAGCTCCATGTTTGCCAACAAGAAGTTCTCCTGATGCTAGTAGCCGCTGCATTGTGCCTCCCGCT
GCATTGTCGATCACTTCGCAGTGCTCGAGAAGAGTCTCCCGTCCTGCCATAAAGTCGTTCAGGAGGCGTCTTACGTTTTTGATTATCTGTCTTGAAGCGC
CGGAAGCGTCTATCGGGTTGCAGGTCCTGACACCTCGCGCTCGGAGTCCAGCGATAGCCTCATCCAGAGCCTTCTGGTCCTCCGTAAATTGTTCGTGCAG
TCGAGTACTCTCTTCTTCCCGTGCTTCTTCCAGGTCGATCGGTGGTTCTTCTTCCTCAGCTTCGTCTTCGGGGACAGTATCGTCCTCACCTTCAGCGCCA
GCCTCTTTCTTTCGCATGAGAGCTAGCTTTCGGCGAGGTGTCGGTAAGCTGGCAGCCCATCGATCTAACAAGGTGTTCACAACGTCATCCTCTGACACTG
TCAGCGGAACCACAAGTGCTGGAACGAGTCCATGCTTGAAACACATCTCCAGCATCGCTGTGGTTGGGATGCGTGACGGTTCTGACCCCAGTCCAGCGAT
AATCCGCGCTACAGCTTTCTTGGGTGTTGGTTCTTGACGTTTAAGCTCGAGCTGAAGGGATTCGACAAACATTTCCTCTGAAGTCATGCGTGCTTCTTCC
GGCTTGAGCTCCTCTAGCAATCGTCTTCGTTCTGCTCTATTTGCAACAACGGTCAAGTCCAGATTGAGATATTCCACGAGGGAATCCGATTGAGACTTAG
CAAGTGCCGCAGTGACCCGGCCGCGTCCGGATCCTCGAACACCAAGCACCAATACGCATGGTACAAAATTAGTGGTTGACCGAGGCCCGTTTGGGATGAA
GGTTGCTGGATTTCGCTCGAAAGCAAGTCGCTCCTGTTCTCCAGCGAAGGCATAGAACTTCTGGCGGAACAAGCAAACGTTGGTTGGCAGTCCAGGTATC
AACAAACCACGGGTGTGCCAAGTCACGGGGCAAAAATGTCCACACTCTCCCTGAAGCTGCAGAGCTCTACTTCTTGCTGCTTTGGCTTGAGCTTCCGCTT
CAGGGTCGGTGACATCGACTTCATCTCCTTCCTCTGAAGTTGATGTTGATTTTCCTTCGTTAACTTCGTCATTTTCCGGTAGTGGTGAGGCAAATATGAC
AGTTGGGTCGTACTCATCAACTAGCTCTGGAGCATGTCCGTCTTCGATCCTGTCCAAACGTGGTGCGATTGGATTAAGCTCTCGCTCGATGGCTGCCAAT
GTGTCACTCGGCTGACGGAACAATGGACACGTTATCACCCGAGTAACACCTCCAATTCCTTGTGAAACGTCCTCAGCGCCAGCCTTTTCAGTCTGGAACT
GTTGACGTCGCAGTGCAGATAAAGCACTCATGTTGGCGGCACTACTTCCTTCGCCATCTTCTTGAACAGCGGCGACCTCTCTGTCCAGCAGCAATATTGC
ATCGGGGACACATCCGTGTTCGAGCAGTGCGGCAGCGACATCACGCGTAAGCGGTAAGTCCATGAGCATCCACCCAGAAGACGCGTTTTGTTTCGCCAGC
AACGTTTTGGCAGCATCGGAGGCTATCGCTGCAGCTTCCACGGGGGATACAATTTGTCCGCTCATGAGACGCATTTCCATCGCTATGCTGGGTGAAGTCT
TGAGCAGCTTTGAAGTACTCACGGTCTGCACATGGAGCCCAGCCTCGAGCGCCTCTAGGTATGAGGGCGTGAAGGCATCCCCTGCACCTGTGGTTACGAG
CCAGAAGTTCCGACACTTGGACGGAATTGGAATTTCTCGAAGCAAGAATTGCAATGGATATGCGCAGAAGGCACGCCGTGCTTCTTGTGAAGCCAGCAGG
TAGACCCGACCGGAGTAGCATGCTGCAAACTCAGGATCGCCTAATGTCAGAGCACCAACAGAAGTCGAGACTACAGGACAAAACTCTCGCCACTTCGAGA
GCAATCGGCGTTTTGCATCACGTCTTGGTAGTCTTGCGAACGACTCGGTGGTGGAGCTTGCTTCGGCTTCAAGAAGCGCGGCCCAATCTCCGTAGAGTAG
CCACCTCACTTTTTCAGCGCGGCTGGAACCATTTAAATTCTCCGGCAGAGATACTTGACAAGCTTCACGCGACGTACTAAAGCGCGAGAGGCCTAGAGGC
GTCTGTACAGCACCAAAATACAAGCACGCCGAATGTCAAGAAACCAAAAACAAGCGCACAACTATTGGCATCTCTACTTACACCCGTGATCGTCTGGATG
CAGTGGTCTCGAATCACGTTGAGAGACTGAGTTGACAGAGCCACCACCAAATGACAATCCGATCGCTTTTCCGTTGAGTCAGCAACTCGACGTGTTAAAA
GTTCTCGCTGCATTCGCGTCACGTATTCGTGGTATCCCTTGGTGAATTTTGCCATCGCTATTGAACCAAACGGCAACGTGCGTTCTCCGGGAGGTTCGAT
CTCGTTGCGTTCGGCAGGAGTTGGTTCCGGTGGTAGTACAGGTTCTTCTGATAGAACTTGTCCACCGTCTCCTTCCTCATCATTTTCCTCTGGAGAAGGA
GATTCGTCGACTTCTTGGTCTTCGCTACTAGCTCCGGCATCACCGTTTGCAGTACTACCATTGGGCTCCTGCACTTCTTCGGCATCAACCTCCGGTTTCT
TCGGTGGTTGTAGACAATCGGCAAAGCCTTCAGCAACCAACCCCTCAGCGTGTGTTGCTTTCAAAGTGGCAAGTTCTCGTACTGAGTACAGACGGCCCGC
TGCTGGTGCTAGTTGTGAGCCTTGCAATTGGTGCTCTATCTCGGTGGGAAGTGCTGTGAGGGCTATCAAGTAGTCTACTGCTATGCTGTGCCCTGGGTTA
TCTGAAATTGAAAGTTCGCACGGGTAAACATCGTCCATAATCACACCGACGCCAGCTACAAGAAGGGAATAAATAGTGAGTTTCGCTTTGATTTCATCAT
CGATAAAGCTGCAGAACGTACCGAGTAAAGAACGAGTGGCTTCCAGTCGAAACAGATCCAGTGCCTTGCTCCGAGTAACCACACCTCCAGCACAAAGAGC
ATCGAGATCTTCATCTCGAAAAACCTGGTCTATGGATTCGTCCTCTCCAGCGTTGTCAGTATCGATTTCCTCGTCTGCCTCCACCGTCTCCATCTCCAGA
GGTGTCTCCACAGCTGAGTCCTCTCCCTCTACAGGGATAATGACGGCAGGTCGACGTCGACGTATGCGGAGCTTGTGGTCAACCGCGCGCTGAATAACCC
CATCAAGTGACAAATACCTTAGTCCAAGTCGTTGAGCTAGCACACGGGCAAGTCGAGTCTTGCCACACCCAGGTGGCCCCACCACTGCAATTCTTAGTGC
AGGAAACTCGGTCAGAGCTGCAATAAGAGCATCCTCGGGATTCCGATGTGCTGCAGTTTCACGGTGGAGTTTTCTTCCTCGGACGGGGGTTGCCCCCGAA
CCAATAGAGCCCATGAGCTCCAGATGCAAACGTTTTGCCACTGCCATTTCGTCTTCGACATCGGGCTGAGGAGTATCAACGGTATCTGCCTTGGCTTCCT
CTGCTACTTTGGTGTCACTGCCCTTCTTTTTGGAAAACGCACGGGTGAGTGAAAACTTTCGTGGGTTGTAGCACAGAAGAAGCTGCTTGAGTGACATCTC
ACGCTGGTCAGGAGATTGAAGCCCTCGGATACTTCGTAAGGCCTCGCTCGAAGGCGGTAGCTTTTGCAGGAACGCGTCATTCGCAATTTTCGGGATGCGA
TTCAATAGTCGAAGCGTGAAGCGGTCAACCGGCTCAGTGGAATTGGTCTCATCTTGCTCCGGTTCTCTGCCTGAAGGAGAGGCAGCGAGTTCCGCTACAG
AATTGCGTAGATCCCGAAAGAAGGCCGCGAAAACGCTGGGTGCACTCTCAACCGGTAAGATAATCTCCGCGAGCTGCATGACTGCCTCGCGGAATTGCAC
GGCTGACATGACCTCAGCGTCCAGACTTGAAGCTGCTTTGGTAGACTCATTGACGCTGCCGACACCTTCTAAATCGTACTCCCAGTCGCGTCGAGCCGCG
AGGATCGCAATCGCATCGGTTGACAACGGAAGTACCAGTGCCTTTCCTGCTCGAGCGAAAAACTCAACGTATCCGTCACGCTGCAAAGTACGTGAATTCA
GGGGCTTGGCTAAATCCCAAAGCAGTGTCAATTCACGACCAACTAACGCGTTGTTCGCTTCACCCCCGTCGGCGGACTCGTCACCTTCCAGCATCGCATT
TCGTCGATTGTGCCATAGTCGTAGCAGGTTGGCCTTGCCGTCCCCAACACTACGTTCCTTTTCATCCTCGGCGAAGAGGAAGTGTCGACGCATCGAAGCT
CTGCACCCGTCTCGATGCTACCAAGCTGCGTCGAAAGATAGCACAGCTTCGAGGGCTCCTCTGCGACTGGAGTTGATCAAGCGGACGCGACGGCTTAGAG
GGGCAACGTCGATGGCAGTCGTTCGTTTCATGTTATCCCGTTTATAGTTGGGCTCTGCGCTCGTAAAGAGCGCTTATAAGCGTGTTCTAGTGCTAGACAC
GAGTGGATGCTAGTCGGCTTCTAAGCTAGATTTCGGGACGTCAAGGCCACACGCGTAGACTCGAGTGCGATCTCAGTACTTGCGGTGCGACCTCGCGACT
TTTTCTCGGTCGGGCGCTGGTGCTTCTTCATCAGCTCCTCACCCTTCTTCTTGAACATATTGCCGATGGACTTGCGTCGAGACTGCTGCTTGCTTGTTGC
AGATTCCTGCTTCACCCACGGATGCTGCAGAGCTGCGCTCACCGTAAGTCTTGATTTGGGGTTCACATCGAGGAGACCAGCCAACAGGTCAACCATCGCG
GCCGGCATCTGGGAGAGCAGCCCAGTCTCCTGGAGAGCAAACGCAGTGCCTCGTTCAGTCATGCGGCAGAATAACTGGTCGCTGTCAGTACACGCGCGAC
GCACGAAAGCACGCTTGGTGCACATTGTCCACAGGATGACGCCTAGAGCCCAGGCATCAGCTTGACGTGCATCTTCCACGTCTTTGCGAGCTAGCAGCTC
CGGTGCAGCGTACGCTTCCTTGGCAGCTTGTACGACCTGTACGCTTGGTCGCTCGTGCTTGAATCGCTGGGCGTGCCCCAGATCCCCGACTTTCGCGACG
CTTGAGTCTGTGACGAAGACGTTTTCCGGTGACAAGTCCAAGTGAGCGATTCCAGCGCAGTGGAGAGCCTGCACACCTCGAAGCACGGCAGTGAAAACAC
GGCGTCTCCCAGCGTCAGAGCAGGTCATCATCGAAGAGCTGTGAGGTGGCACGCCCGCCGTTTGAAGGCGAAGTTCTTGCTGCATGATTTCAAGCAGGTC
GCCGCGGGCGCAGTGTTCATGCAGTAGGTGGAGTCTTTCTCCTTGCAGCAAATGCCGTTCCAGCTTGACCACGTTCTCGGCGTCTCGAACCGAAAGGTGG
AGGTCCAATTCGTTCAATGCAGCAGCACTAGCATTACGACCTTCACTGGTGGAGGAGGTCAGGAGGGTGTGCTTGTCGACAAATAGGCGCCCGGAGGCAG
CACACTCCACCAGGTCCACACACTGGAGACCATCAAAACTTTCTTGGATCCGCGAATGCAGCGTCAGAGGAGCATTGGTGACGGGGGCCATTATGAACTA
GAAAGTAGACTTCACCACTTACGCGGCGTTTTCGAGAGTGAG