Description :
From Genome Similarity Track
Location :
Scaffold_963:11548- 12696
Transcript NameFunction/comments
Phypl_g11834hypothetical protein

Sequence
1148 bases(100 bases per row)
TGTCGATCGTCGTTTACACGTTGCTTTGGTGTGCAGCCACTCACGATCCAGTGCTACAAGTGCCGTATACATGAAGGTAACATTGCGGTCAAAAAGCATG
GCAACAGGCTCAACCAGAACGCATCGACAGTCGACGCAGTTTAGCTTGTGAAATGGTTTAAGAAGTTTGCAGCTGAGGTCAGCTAGGTGGTGCCCGTGAG
GGTTTGCATGCAGAAACCCAAGGACGGGAAGGTGAAGAATTGCAGCCATGAAGATTACTTTCTGCTACCTGCGACGTTCAAGTGAGAAGCTGTCTATGAC
GAGATGCACAAGTTCGTGAATATGGGACTCCGCGTTAATGAGCCTGGACGCTCAACGTTCCGCAACCTGCTGTCACTTTACTGCCTCAACATCAAGATAC
GGTCTGCGCAGTCGACCGTATGTGACATGTGTACTATATGGCAGACGCGCATGCGTCGTGGAGCGTCCACTGAACTAACGAAAGAACTCGACCAGCACAC
GGAGTCCACGCGTCGAATGAGGTACGTGGATATAAGTATCATAGTGATCTATCAGGTGTTTCTACCTTGGACATCGATATCATTTGGATCTGCTGGTAAC
ATATAGGCGTGAGTACAAAAAGGATGAAGCCACAGTACATGCAGAAGAGGGCAGCGACATGGCAGTGATTGCCATGGACTTCTCGCAGAATCTGACGATT
CCGTCAGTTACCACCACGCCGTCGCAGTGGTGTTTCAGTACGTTGCTGGCTGTGAATGTCTTTGGCATTTACTACGAGAACGAGGGGGCCCAAACCAACT
ATTTGTACGACGAGGTTACAAGTGGAATGGGTAGGGATCAGATTaactcgatgctgcagcacttcatTCGTACGGTGCTACTACCTGCCGGTAAGAAACA
CCTCGTGGTCTACGCAGACAATTGTTCAGTGCAAAACAAGAACAACCACGTGATCAAGTTCTTCCTGGCTCAAGTTCAGATGGGAACCCTCGAGCAAGTT
GACTATAATTTTTTCGTCATGGGACACACGAAAAATTCCTGTGATCGTAGTTTCGGTCACATTCGCAAGTACGTGGGCCGCACGGACTGCCAGACTATGG
ATCGCATGTTGCCGCTGTTAATGGTTCCTCTACCTCTAACACTACGGT