Description :
From Genome Similarity Track
Location :
Scaffold_1141:11547- 13207
Transcript NameFunction/comments
Phypl_g12541Amino Acid-Polyamine-Organocation (APC) Family

Sequence
1660 bases(100 bases per row)
TCGAGCACGTTCAACGTGGCGTACTcgttgttggcgctggcggttgTTCCAGTCGACACGATTATCTCGAACCAGtcaacgctgctgtcctACATGGGTC
GCCTCAGTGGAGGCCGCTGGCTGGAGGTTGTCGTGGCTATTGACGCCTTTGGTGTGCTTGCTGGCGCGGTGCTGACAGCCTACGTGGGCATTAATGGGCT
TTTCCAGCGTCTGGCAATTGATCGTGTGTtgcccagcttcttgctcaaGGTGAACTCGTGCCGTGGAACGAATCACTATATTATCCTGGTTTTCTGTATC
GTGGCCTCGAGTCTCGTGTTCATTTTGAACGCCGAAGTGACGGTACTATCGGGGGTGTTCGCGCTTGCGTTCCTCTGCGTGCTGCTATCTTTCACCATGG
TGTGTCTCCTCCTGAAAATCTGTCGGGAGGAGATTCCGCGCAAGAGGACTACATCGTGGGCCAACACGTGCTTCTGTCTTGGCATGATTTCGATGGGCAT
TCTCGCAAACGCGTTCTCGGATGTCAGGGCGTTGTCGTACTTCTTCATCTACTTCACGGTGTTCTTCCTGGTGGTGTTCCTGATGCTCACGCGCGTCAGT
CTGCTCAAGGGGCTACTCTTCGTTTCGCGGAAGCTACTGCTGCACTTCCGAGGCGGACAAGGCGATAGTACGCCCATACAGCAAATTTTAGCGGGTGGGC
AGGCCTTCGTTGGTAGCGTGAAGACCGCCATGACCATTGAAACAATCAAGAACACACCCGTGGTGTTCTTCTGCAAGGTCGCAAACTTGCCGAAGATCAA
CGAGGCCGTGCGCTACGTGATGCAGAACGAGCACACGTACTGCTTGCGGCTGGTTCACGTGTGCGAGCCGAATGCCCCCGTTCCACGGGAGTTCGAAGAC
GTGGTGAATTTGTTTGACCACATTTACCCGTCGATCAAGATCGATTTCGTCGCCGTGACGGGCGCTTTCGACCCGGCGATGGTGCAGTGGTTGTCCAAGT
CCATGGAAGTTCCAACCAACATGATGTTCATGCGTCAACCTGCGAACGAGAACATCCACCGCGTATCGGCACTGGGCGTGCGAGTTATCACTGACTAGAA
AGGCGTGCGAAGTAACTCGCAAGTGAATCGTCTCGCTAAATTACCAAATGTAAAGAATGCCTCTGAAAACGTACTTCAAGTACTTTGCAGTATTTGTCAA
CGTCATTGAGTCGTGCGCCGCAAACAAAATCAAGGTCAACAATTCGGTTAACGCGCAGTTAATATGCTGAGCATATTCTTTTGTGATAGACAGCCATGGG
ATGTGACCCGTGTACAGCGTGCTGTCAAATCAAAACCGTGACGTTAAGGTGCTCACCGTCTAACACACTGACCGACGAGTTGCTCCCGTTGATGCTTAGG
ACCATTTTCTCCGTCGGCTGCAGATGGAActcctgctcgtgcggcGGTTGCTGCGGACATAAAATCCAAACAAGGATGACAGCGTTAGTCATTGGAGCCA
CCTCAATCTAATCTACCACACAACCACGCATCATCTAGAGCTCCATAATATctcgcagcgacagcatcagCTGCCCTTCCTGACGAAGCCGAACGTCTCG
ACATGACGCACTGTGAATAGCACAGCACGCCCATGACCTGGTCCGTGTCCACGTCTCCGA