Description :
From Genome Similarity Track
Location :
scaffold_4:115462- 122154
Transcript NameFunction/comments
Pl_112915hypothetical protein PHYSODRAFT_328767
Pl_112916hypothetical protein PHYSODRAFT_489031
Pl_112917hypothetical protein PHYSODRAFT_489802

Sequence
6692 bases(100 bases per row)
CGGTCTTACAGGGAGATCCGCGCCGCCCCGGCGACTTGCATCCATTCGTGCGCGAACAGGTGGACCCAGACGACGCCCCCGGCGACTGGTACGCTTTCTT
CTCGCTCGTGTTGGGCTTCCTCGCGTTCACCATGAAGGTGCGTCATCTCCTTATCGCTATACTTGGCGGTGATAGCTAATACTCCTGATGTATACGTAGT
GGAAGGAATTGGCGTGGGGTTCGCTGCTGCTCTGCGTAGGCTCGTTTACCAACATGAAGTCGCAGGATATGAACATGACGCAGGTTGCCATGTCCTTCTT
CTTCTCCACTTCGGCCCTCGTGTCCGCCTATATGGGGGCCATGCGTCCGGGCATGCCCATGCCGTCCGCCCAGATGGTCGAAGCCCCAGCTTCGTAGAGA
AGAAGCTATAGGGAGAGTATATCCAGCAGGTCCAGAGGCTGTAACAATGGACGTTGGTACTGTGCTTTGATGTTTGAGTTGTGCATTACTGGGTAACGAC
CAGTGGTGAGTGCTATTTAGGACAGTTTAACAATGACAATCGGGCCTCATGCAGCGTACTCGGAGAGATTTGGAGAGCGGACGAAGGAGTCACCTCGAGG
AGATGGAGATTGGTATCAGAATACCAACAATGAAGCTGGCGGTATGCTACCTCAGAAGCTGATGAAGCGACCTCGCGGCACGACATCGACAGCACAGGCG
TTGGTCTTGCCACCTATCAGACCAGCAAGTCCTGCAGCTTCGACCATAACTCTAGAAGAAAAAAAACAGCGACAGATGCACTCATTCCTGCGCAACTTCC
TCGCTGCCGGTGAAAGTGGACGCTTCCAGCAGGTGATCGACTTGCATCAGCACGGAATTGACACAGGGATCGCGGTGACTGACGCGACGCTGCAAGAAGT
GGTGCTTACAGTGCCCAATCTGCGTGGATTAAACCTCTCTGGATGCTCGCATATCACGGACGCCGGTCTCTGGGCGGTGGCCAGGCACTGCCAGACACAC
TTGGACACTATTTATCTAGCGCAGTGTGAAAAAGTGACGGAGCTTGGGTTGCGTCTTCTCGCTCATAATTGTAGGCTCGTACTGGTTGATCTGAGTGACT
GTTCTCAGCTGAATGACACCGCGTTGCAGACACTAGCGGCTGGTTGCTGGATGATTGAGACCTTTATTATGAAGCGATGTCGAGGAGTCTCTGATGCTGG
CATCGTTAAAATCGCCCAATGTTGCAAAGATTTACGTCACCTCGACGTGTCTGAGTGCTCTCGACTCGGTGAGTACGGCGACAAAGCTCTGCTTGAAATC
GGGAAATGCTGTCCGAAGTTGCGAGTGTTGGATCTATTCGGCTGCCAGCATGTGCATGATCCTGGCGTTCGCGCTATCGCGAAAGGCTGTCCATTGTTGA
CTACGCTCAGGCTTACTGGTTGCCGAGATGTCAGTAGTGTTGCTATTCGTGCATTGGCACAACAGTGCACACAGCTCGAGGTGTTATCACTCTCTGGATG
CATCAAGACAACGAACAGCGATCTCGAGCTTCTTGCTACTAACTGTCCGCAACTCACGTGGCTTGATATCAGCGGCAGCCCGAATATTGACGCACATGGT
GTACGTTCACTAGCCCAGAATTGCATTTCGCTGATGTATTTGAGCCTGGCAGGATGCCAACGTGTAGGAGATTCTGCGTTGAACGAGCTTATCAGTGCAG
GAACTGGAGGACTTACAAAAACTTTAGCAGAGTTATCGTTGGCAGGTTGTCCTCGAATTACGGAAAATGGAGTTGACACGCTGACTACGGTCTGCTCCAA
CCTTATCACACTCAACCTCACCGACTGCAAGCAGATTGGCAGACGATTCCTCCAGAGGCTTATTACAAAACTTGAGTTCGTACAATGGGCTACGAACTTC
TTTGGATATGAACCACTACCGAACGCTGCTGAGCTTTGCCGTCAGCGCGATCTCCGCTTGTTGCAACTCCAAAGTGCAATCAAAATTCAATCTGCGATTC
GTGGGTGCCTTGCTCGTGGTGGATTGTGGCAAGCAAAACTTAAGTTTGTAGAGCGAAGGATATTACCTAAGATCCAAGGCCGTGTGCGCGGGTTCTTGGT
ACGAAAACGTATTGCAGCAGAAAAGCAGTATCAGCTAGAAGACCACGCTGCTCAATTGATTGGGCGTGCGTATCGCGACTTGCAGCTTCGACGGATTCTG
GCACGGGCGAAGCGAATTCGTAAAATTAAGGAGCACGAAGATGTAGCAGCGCTCATCTTCCAGAAGATTTTCCGTGGTTACCGTGATCGCAAACTCGTCG
CGAAGATGCGATACGATATTTATTGCGACCAACAGTTCCAAGCTCGAGTGTTAGCCATGGAGAATATTGCAGCCACGAAATTGCAACGTGCTTACCGGGG
GCATCGTGGGCGGTCTGATGCTGCCATGTTGCGCTCAATAATGGAGGCACAACGTCTACAGCATGAGCGAGAAGTTCGTTCAGCAGCGTATATCCAACGC
GTGTATCGAGGCCACAAAGGACGTGAAATCCGTGCTCAACGACTTGCAGAGTTGCTTCACCATCAACAATGCCACGAAGGAGCTATCAAGATGCAGAAAG
TGTTCCGTGGCCACCAAGCGCGACGGCACGCAGTTATTTTGCGAGAAGAAGCAAATGAGCTACGGATACTTAATGCTGTGCTGACAATTCAAAAGTATTG
GCGAGGTATTCGCGACAAACACTTAGCTGCCGTACTGATCGGGTTGATCAAGCTGCGCGCCCGCGAAAACGAGGCTGCACACGCGATCCAAGCGGCTTAT
CGTTTGCATGCGTCCCGGGGATTCATGAAAGCGATGAAGCTAGCTTTAGCGGCGCAGTTAAGACTAGTGAAAGCTGCAACTGATATTCAACGTCTCATAC
GAGGACACCGTGGGCGGGGTGAAGCAGAACTTCGGAGGGAATTGCAGAGGTTCCGTTATCAAGCGAAGCCTTTATTCGCGAAAGAATCACGCTTACAGGG
GCTTGTGGATGACTTAAACGAAAAAGTGGAGCAGCTACAGCGCAAAATCGCTGCTGATGAAGAAGCAGAGCGATCATTAACGCTGGAGCTCGAGAAAACA
CTTCGGATTAAAACAAAGTACCACGACTCGAGCCGTATCACTGGTACACCTCAACGCTATCTGACGGAATATCTCCAGGTCCAGCTTGCTGATCAGCTTC
GAGCAAAGCGAACTGAAATTGCGCTTGATGGACGGGCACTTGAAAACCTGACGACAAACCTGAATGATTCTCAGAAACAGTTGCGTGGCGTTAGGCGAGA
GCTCGAACCGCTAACTGATGGTGTTATCAGGAAAACTCGGGAAAACCGAGTGAAGAGATTGCAGGATAAGGTTCGACACGAGCGTCACGCAGCAATTACC
ATTCAAAAGATATTCCGCGGTTTCCGTGTACGATCAGCAGTTCGAGAGGGTGGCAATTGTTGGATTCAAATGGTTTCACCTGAAAATGCTCGATCGTATT
TCTACAATGTACTTACAGGTGCTACCCGATGGCACCGACCATTAGCAATGGACATTTTCGGAGATCAATATGTAGAACCCATGAATGAGTCTGCAGAATC
GTCAACACAGATTGCTGTACAACAACCTCCAAGCAGTCCCCACAGTATTTCGCATCGACAAAATACTCACAATGATAGATGCCAACCTACTCATAGCAAT
TGGTATGAAGCTTTCGACGACAAGGTTCAATCTTCGTATTATTTCAACAGCCAAACCAAAGAATACCAGTGGGATAAACCCGATGCTATCGACAATGCGT
ATTTCACCGACAGTCAAACGTCTCGAAAGCGGCAGGAATGGCTCGATGAGCAGCTACAAGACCCTGAAGGACTATTAGCATCAACAGAAGTCCGCTTGCC
TTTGCTAGGCCAGTGGGAAAAGCGAGCTGATCCAGTCACTGAATATACTTTCTTCTACCATCCACCTACTGGAGTGATCAAAGCATCGCTGTCACCACGA
AGTGTCCATGCATCACTTGGCGACATGACCATGAATTCTCGCCGTTCAGCTCGCAGTATCGGAACCTCTCGATCTCTTCAATGGCAATATCGATACGGCT
ACGAATATGATGCTAACGGGAAACTAATCACGAGCTCGAGGACGCAACCACGACCTATTTGGACTGAGCACATGGATCCAGACAATGGCATGACCTACTA
CTACAATGTGCTCACCAACGATTATCGATGGGAAAAACCTGAAGACTTCGACATTAACTACGAAACATTCGCTACTGGACGTGGTGCAAGTGCTTCCGCT
CGTAAATGGTTTGAGATGGCTCATCATAAGGCTAGTGATGATGGTAGTAGCTCTCTCACTACTCGATCGTCGAAATTGCGCGCTCTTGGTAAGAAGTGGG
TCGAGTTAGTCGATCCAGAGACGCAGAATACATACTATTACAACGAAGTGACAGGAGAATCGAGGTGGTCTCTCTCCCCTCACAGTGCTCGCGACACCTC
CGACACAGAAGACCAAATCTCTTTGGCCCTCTTTGCGCAAGTTAAGCAGCTTCGTGAGTCTCCTGTGCCATATTCGTCTCGGGACCAACACATGAGCTGG
TTAGAAGCAGCTATCACCGAGAAGGACTGGAAAAAGGCTGATGCTATCGTCCAGCAGATTTTCATTCGTGAACAGAGTCAAGCGGTGACTGAGCGCAAGT
CTAGAGTGGAAGATGCCAAAGCTACTGAGAGAAGAGGTTTTGAGCAGGATGCAATTCCAAACGCTTGGATCGAGTGTCGAGACGAAAACAGTGATGTCAC
GTACTACTACAACCAGGCCACAGGAGAGACAAGCTGGAGCAAACAGCCGGTGGAAGCTGCGTCGTCGGCAAGACAATGGGAGGAGATGCAGGACAGCGAC
GGCAGGACTTACTACTACAATTCGATAACTGGCGAGACAGCTTGGTCACCACCAACATGAGCTTGTACAAAATACACTTGCCGCTCACAAACGATAACTT
CATTTCGCTGTACAAACTACCCACAAGCGTGGTCATGACAACTTATGGCTCCAGTCCACCCACGCAAACCATCTTCGTCTCTTGATACTCCTCCAGACCC
ATGAACGAACCCTCACGTCCCAATCCAGACTGCTTCACTCCGCCGAAAGGAGCCTGCACATTTGAGATCACGCCTGTGTTCACACCGATCATACCGCAGT
CCAACGCAGAGGCAACACGCCACGTACGTGACAGGTTCTGCGAGAAGAAGTATCCAGCAAGACCAGCCTCCGTTCCGTTGGCCATCTCAATCACCTCCTC
TTCAGTAGAAAACTTAAACAGCGGGACAACAGGGCCGAAGATCTCCTCACTCCAGACACGCATTGTGTCATCCACATGGGCCAGCACAGTAGCTTCGTAG
AAGTTGCGTCCAATGTCGCTACGTTTACCACCAACGAGGGCCGTCGCACCGTTCGTGACAGCATCTTCCACCAGTTCCGAGGTCTTCAGAAACGCATTGG
GGCCAATAAGCGGACCGAGGTTCACACCTTCCTCACGAGGTGGACCCATCTTGAGCTTCTTGACGCGTTCCACCAACTTGGCCGCAAACTCGTCGTAGAT
ACTGGCATGAATAAAGATTCGGTTGCTGCACACACACGTCTGGCCCGTGTTGCGGAACTTGGAGGCCATCAAGCCATCCAAAGCCTTGTCAAGGTCGGCA
TCTTCGAACACAATGAATGGAGCATTGCCGCCAAGCTCCAGTGACACGCGCTTTACAGTCTCCGCGGACTGTTCCATCAGCAGTTTACCAACGCGAGTAG
ATCCCGTGAATGAAATCTTGCGGACATCATGACTACTAGTCAGAGCACTACCGACCTCAGCCGCCTTGTCATTAGGGGATGGCACCACATTAATCACACC
TGCGGGAATACCGACGTCATCCGCCAATTTGGCCAATGCCAAAGCAGATAGTGGAGTCTCAGCTGCAGGCTTGACTACTGCAGTGCATCCAGCAGCTAGA
CATGGGCCGAGTTTACGGGTGATCATAGCTAGAGGGAAGTTCCAGGGCGTGACAATGCCACAGACTCCAACAGGCTCCTTAATAGCCATGATCCTGTGAT
CGGAAGCCGATGGAGACGGCATAAAGCCGCTTGAATGCATGATCTCATGGGCGTAGAAGTCGATGAAACCAGCAGCATAAGCCACTTCACCCTTGGCCTC
AGGCAGCGGCTTGCCGCTCTCTACGGATGCAATCACAGCCAGATCTTCCGTGTTGGCCACGATGGCCGCGTGCCATTTCTTGAGCAGAGCAGAGCGCGCA
GCGGGTGTGGTCTTGCGCCACTTCTTCTGAGCTGCTAGAGCCGCCGCGATGGCCTCGTCCGTCTCGACGCGTCCCATGTTGGCAACGCGCGCGATCTCCT
TGTCGGTAGATGGATCGATCACAGCGAAGTGTTTGTTGGAGTGGGCCTCGACCCACTTGCCGTTGACGAAGCCGGCCGACTGGATGAGCTCCTTGTTGTG
CACTTCGGCGTGGAAGAAGCGGCGGGAGGCCGAGGCGGCTGGCAGCACAGAGCGATGGATCTTGGACGACAGCATGGGGCTTGAGCTCGACGAGGCAAAT
TCGGAAATGACAGATCCCGGTAGTTGAAACGCCCAATTGGGCTCTTTGAAGTACGTCAGCAGACCCAATTTGGCGTACGCTCGCACATAATG