Description :
From Genome Similarity Track
Location :
Scaffold_421:11546- 13455
Transcript NameFunction/comments
Phymu_g9731hypothetical protein PHYSODRAFT_467093
Phymu_g9732conserved hypothetical protein

Sequence
1909 bases(100 bases per row)
GCTGAGAGATGCAGCAAGAGCCCGAAGTCAAACGTCAATCCGCAATCTTTGTACTTGTCTCCAAAATCGAcccatcttctccaccaatGTTATTTTTCCC
GTACCCGGCCTCTGTTCAACTCACGAGACTCTGTCCCGCTGGATACGAAGGTAATCGAACCCTGTAAAAAAATCCCCCACCAGCAACTTACTCTGCGTGT
CAATCTTCTTGCAGTCCGTGAAATCTTTTCCAGTGAGTCCGATCTACGATTAACTTTCGCAGGAACCAAGCGCTTCCTGTATAACGCCATCACCAATTCC
CTCCGCGCTACTGGTGTCCGTAAAACGGCATCCAGCAACACGTGGAACATTTTCTGGGGCGAACATTTAAAGGCTCAAGAATTCTCCTCTTTGTTGCCAT
TTCAGCGTGTAAATCACTTCCCAGGGAGCTTCGAGTTAGGTCGGAAAGATCGACTCTGTGGGCACTTGTTGCGCATGAGGAAGAAACACCCTACAGCTTA
CGCCGACATCATCCCAGAGACGTATCTCACAGCAAACGACTACGACAAGCAACAGTTCTTAACGCGCTTCCACGCTGAGCCCAACGTCGTTTGGATCTTG
AAGCCACCTAATTTATCTTGCGGAAGAGGTATCAAACtcgtgtcgtccagcacTCATTCGACGCCAAAACtatcgaagaagaaagcctACGTCGCCCAAC
GCTACGTCGCCAATCCATTCCTGATCAACGGTTTAAAATTTGACCTTCGCGTTTACGTAGCAGTGACGTCGTACGATCCTCTACGTATTTACCTCTTCAA
CGATGGTTTGGTACGGTTTTGTACGGAGAAATACTCCACGAGCAAGAGTGCATTACAGAATCCCTTTGGCCATCTGACCAACTACAGTATCAATAAGAAG
AATGCTGCTGCGTTCCAAAAGAATCAGGATGATGCTCAAGCGGACGAAACGCATGCTCTATCAAGTAGCAAATGGAGTCTCCAAATGCTCTTCAAATACT
TACGGGACCAAGGAAAAGCTCAAGAACTTGGGAATTTCCAACAAGCGCTCGAGGATTTGATCGTAAAAACTCTAATTGCCGTAGAAGAGAAGCTagcttc
agcctccagtGGGAGTAGTGGTCGTCGCAACGGGTTTGAGCTGTACGGGTTTgacgtgctgcttgaaggCGACAATATGACGCCTCGTCTACTGGAGGTG
AACGTCTTCCCATCTCTCAGCAGTTCGTCGCCAATGGACAAGCGCATCAAAACTGTTCTCGTTAGCGACTTGTTTCAATTAGTGGGTATCCCCTTTGTGG
ATCCACGGagagaagctcagcaactgGATAAGGCTAAGCAAGATCGACTGCACGGCATTAAGCAGCCTCGGCAGGCCAGCGCTGGAACAATCCCCCGAAA
GGAAAAAGTTgcacaacgacgacgacgtacGCTGGAAGAGCTACAGGGATCGCCAGGTAATTTGCTTTTGCCCCAAATCGAAGGTGAAGATCTTCAACTG
ATCAAGGaaatggaggaagagctccatcgGTGTGGCCACTTCAAACGAATTTTCCCGACTACACAGGCATTTGACAGGTATTCCGAGCTTTTCGAATCGC
TGCGTTATCGAAATTTGCTAGGTATGAAATGGCTTCAGCAGACAAACCAGGATGGCGGCCGAAGACTTCCACCAACTAAAAAGAAACAATGAAAGACGTT
CGCTTTGGTAGATGACGTGGAGTCTCGAACTAGAGGGTGACGATAAGTATCTTGTTACGCACTTGCTGCACCATCTGCTTCCACCTCTTTTCGTTCCTCA
TCATCAGAATTTGCATCAttcacctgcttctcctgtgattccacctcctccaactcTACTTTCCCCACTTCTTTCACGACGTTGAATTGGCTCAGCTGGT
GTTCCAATT