Description :
From Genome Similarity Track
Location :
Scaffold_13:115459- 118075
Transcript NameFunction/comments
Hyaar_Emoy2802414hypothetical protein

Sequence
2616 bases(100 bases per row)
GCGAAGTCTCTCATTGGGCTCATAACCTGTTAAATGTCCAGCCACACTGTGACGGACACAGAGGGAATAGGGACCACGAGCACGGTTTTTTAAGGAGAAA
GAGTAAGTGTGTATTTAGATTAAGATCCGATCATCAATCTAGATACGAGAGGTCGTCTGCTCCACACAACAAATGTCATGTAGTCCACGCATACACATGG
AATATAGACCACCGCGGTCTAAGCTGGTTTAACAGCAGTTCAACATCCACATCAAGATCGTTAAACTTGCAACACAATCTCGTCTCTATGCGTCTCCTCC
ATTATCTCGGCCTTCGTAGCTCGCCGCCTTCCAGCAATCGCTATCGCACGAATACGATAATAAATTCGAAGTAGGGTAGGTATCTCAAAATTAGGATGGT
ATTTTTAATTGGCCAAAACAAATAGCCGGTATAATGACCCACTCGCGACCTGTACGTTTAACCGTTTTCTATAAACAAGGGCACAAGGCCCATCCATCAT
CGGAAGCTTTCAGGTCTTTATAAAACCCTTTTAGTTTCGTGCATAATATCTATTGATCCAGACTAAGGCTCCGACCCAGGGTCATTGGTCCAGGTCAGAC
CCCGACCCAGGACCCGGACCAGCTGGTCCAGGGCAATCCATTGGGTCGTCCTGGTCCAAAAACTTGTGTGTAATCTAGAATCGCAACAAAGCCCCCGCCC
AATGTACAAGTGCGAAATGTGTTTCGGATCAAGTGGGCAAGTCATGCGTTCACGTGGCAAGGTCCCTCAAGGAAGCCTTCAAACGGGCCAACATGTACGT
CCAAATATGCACTATAATCGATTAGCATTGTATATGTGGTTGACGTTCAATAGATGTGTATCTGTAATAGGCACATTTCTTCTGCCATGACTCTGCTCAT
TATGCACTGAATTTAATTTAGATCTTGCCTATTCCACGGATCATCGGAAACATATCATTGTACGCTTACATTTATAGACGCACGTACATCTTCCAATCAT
CATGGTTACAAGCTTGTATAGGTGATCGATTGTGTTTAACTGCCATTTTTAGGCGTTTTAAGAGCACGCAAGAAGACGAGGCCGACCACGAGCGCCGTTG
TCACCACATCTCGAGCAGCGGTATATCATCCTCCTTTTTTACTATTGTGCTATTTGGCAACGTGAAACGGATTTCAACTGCTCACGATATCTTTGTTTCA
GCAGGATTGAGCGTTTGGTCATATCGTGCAGGTCAGCAGGGGATCCATACTGGCCAAAAGATCCGAGTGGACGCACACGAGAACTTGCACGTCACTCGCA
TGATGATCAAGGTAGAGGAAGCCACGTAGATGTCAAAGATCGTTTTTTGGCGATGATGCGACTGGCCATGTCGAAATTGGACCGCTGACAAGTCTCATCA
TTAGGCAGATATATTATGGAGCTATAAGCCATGGGCGTAATGCATTCATTTGTCTTTAAAACTTCTGATTGTTGTTGTTGTTGGTGGTGTAGTTGTTGTC
GTTGCAATTGTTGGGCTGCACAGGCGTCAGAGGAGACAAAATAATTTTACATGGATAATTGGTGGTGGGTTCCAAATATATTTGACAAGATCTGTTAATA
AGGCGGCTATCAACATATTTAGCTAGCGTCAGTGAGATCTACGATTCTTGTCATTGTTATATGCAGCAGTTGTTGGGATACTTCGTCTTTGTCGATCAAT
TTAGCCGTCGTTTTCGAAAGATGGCTCATCATAGCAGTCCATAGTAAATTTTACAGATCAATGAAATCGTTTTTCAGCCAGTTCTCCAAACACATGAGCG
CTTGTGAATTACTAGCACTCAGAGAACCGCGGAAGTCAGTAATAATTCTCCTGCCCGCAGAAAAGAGTCTTTTACTTGGTACACTAGTTGCCGGAATCGA
CAAGTATGCCCGTGCCATCTCCGTCAAGCTTGGAAATATTGTAGCTTTTGATTTCCACCAAAGCAGTGGATCTGTGTCGGAGTCTTCCACTTCACCGTTT
AAATAACGGTCAATATCGTCATCGAGATCAAGAGTCTTGCGCTTCTTGTAGAGTCGACTAGAGTAGGAGTTGAAGCCGCTCTTTTCCAAATTGGATGTAG
CCATTTGGCGTTTCTCATGTGCGTTGTAAAGTTGAGCTCTCTTTAAAAGCTGATCGCGTATATCCCAAGTGTCGTCGTTCATGTCGCTGAAGATATTTAA
CTTAATCCGAGGATCAACAATGTTGCAAGCTTGTAAACGTACTGCCCATCAGCTCTCTCCTTGTACGCTTGCAATTTCTTCACCATGGCTTTGATCGATG
ATTCAAGAAATGCACCTTCATATGAGCGAAGATCTCCTTGAATACTCTCCAACAGCATGGCATATACAGGTGCAGCTGGCATAATAGATGGATATTTCGA
AGATGACAAAAGCACGGTAGCCTACAAAACTAAAACAATATTAGATTTGACCTGTTCTAATTCATAAATGTCCACTAAATGCTTCAAATACCTCTTCCAA
TGGTTCGAGCAGCTTAATAACTTCTTGCACCAGAGCCCATTCATGTTCCATAATCACATATCTCTGAAGCTCTACGTCGCTGTCTAAATAAGCTGGAATG
ACTTTGCGAAGAGAAA