Description :
From Genome Similarity Track
Location :
scaffold_437:11542- 13374
Transcript NameFunction/comments
Pl_104864pre-mRNA-splicing factor ATP-dependent RNA helicase PRP16

Sequence
1832 bases(100 bases per row)
CTCCCGATTTTCCAGTGCCGCGAAGAACTGCTGCAGGTGATAAGAGAAAATCAGATTGTCGTGATTGTCGGAGAAACTGGTTCGGGTAAAACTACGCAGC
TCACACAGTACCTGCATGAGGAGGGGTACTCTCAGTTTGGAATGATCGGGTGTACCCAACCGCGTCGTGTGGCAGCCATGTCTGTGGCTCAACGTGTTAG
TGAGGAAATGGAGGTGACGATCGGCGAGGAAGTGGGTTACGCGATTCGATTCGAGGACCTTACGTCGGACAAGACTATCATCAAGTACATGACAGAAGGT
GTGTTACTGCGTGAGTCCCTTCGTGAGGCCGATCTTGATTCCTACTCGTGCGTGATTATGGACGAAGCCCACGAACGTGCTCTCAACACAGACGTGCTCT
TCGGTATCCTGCGCAAGGTAGTTCAACGTCGCAGCGACTTCAAGCTTGTCGTGACATCCGCTACATTAGATGCAGACAAGTTTGCCAATTTCTTCGGTGG
TGTGCCCATGTTTACTATTCCTGGTCGGACGTTCCACGTGGATACGCGGTATGCCAAGTCGCCCAGTGAAGATTACGTGGATTCTGCAGTGAAACAAGTC
ATGCAAATTCATCTATCTCACCCTCCAGGTGATATCCTGGTATTTATGACTGGACAAGAAGATATTGAAGCAACTTGTTATATACTAGCAGACCGGATGG
GCAAGCTAGACGGAGCGCCGCCTCTCATGGTTCTTCCAATGTACTCTCAGCTACCGGCAGATTTGCAGGCTAAGATTTTCGATGCCTCTGACATTCGGAA
ATGTATTGTGTCGACAAATATTGCCGAGACATCTCTTACTGTTGACGGTATCAAGTATGTTATCGACACGGGCTTTTGCAAGGTCAAGGTGTACAACCCG
AAGATTGGCATGGACGCGTTGCAGGTTAGTCCCATCAGTCAGCAAAACGCGAACCAACGCGCAGGTCGGGCTGGCCGTACAGGTCCTGGTGTGGCCTATC
GTTTATACACGCAGCGGCAGTTTGTGAACGAGCTGCTCGAAGCACAAATTCCTGAGATTCAGCGGACAAATTTGGGCTATGTGGTGCTATTGCTCAAATC
TCTTGGAGTTTCCAACCTGTTGGAGTTCGATTTCATGGACCCACCGCCTCAAGATAACATCATCAACTCCATGTATCAACTTTGGGTGTTGGGAGCACTG
GACAATACTGGCGAATTGACAGAAATTGGGAAGAAAATGGTGGTATTTCCTTTGGATCCACCTCTGGCTAAGATGCTGTTATTTAGCGATCAACTGGGCT
GCTCAACCGAAGTACTTATCGTGGTTAGTATGCTGTCTGTTCCAAGTGTTTTCTTCCGCCCAAAGGATCGTGAAGAGGAGAGTGATGCTGCCCGTGAAAA
GTTCTTCGTCCCTGAGAGTGATCATCTGACACTGCTGAATGTTTATCAGCAATGGGAAGCCAACCGCCACTCTGCCCAATGGTGCTCTGACCACTTTATT
CATGCAAAGGGCTTACGCAAGGCCCGTGAAGTGCATGAGCAGCTAGCAGACATCATGAGGCAGCAACATGTGAAACTTCGCTCGTGTGGCGGTCGGTGGG
ATGTTGTTCGTAAGGCAATTTGTTCTGCGTACTTTTACAATTCGGCACAAATCAAGGGCATTGGAGAGTACGTGAACATGCTGACGGGCATGCCGTGCAA
TCTGCACCCGAGTGCCGCATTGTTTGGACTTGGTTACACCCCGGATTTCGTCGTGTATCATGAGCTTATCTACACAAGCAAAGAATACATGCAGTGCGCT
ACGGCTGTGGAAGGTGAGTGGCTAGCAGAGTT