Description :
From Genome Similarity Track
Location :
Scaffold_37:115419- 117125
Sequence
1706 bases(100 bases per row)
GCATGCTTGGGCCAAAGATTAAAGTCCCGGCTTAATAAAAGGTTAACCACCATTTTCTTCTCGATAAAGTGGTATTTGCGAATCGGTATTGCGCTCAGCT
TTAGTGCCTCGAAGGCATCCCCAAGCGACTCATCGCCCTTGAGTATACTTGCAGTCCTGCTTGATTTAAATATTTTAAATAGGTCCATTGCGTACTTGGC
CACCAGCGCCGGAACACCATGCCGGATTGAGCGGGCAGGCTCCCAAGCGTTTTCAATGTCTTTAAGCCCACGCCATGCCACCAGCAGCTCGAGCTCACCG
GAGGCAGCGTTCACCCGACAATCGACGAGTTCACGAACTTTGAACACGATGCCTTGGAGCGAGACGTGCTCACGGATCTCCGCAGTCGCCTCGAGGTCCT
TATCGTGCTAGAACTTTAGCCGCTACCCGTGCACATCATAGTCAGCTCCTGTAAGTAGATGGCCGATGAGAAACGAATGCAAGAAGGCCTTAACCACTTG
GAAAGGGCCAACCCAGCGTACCAACAGCTTGCCATCTTGGAGCCGCTGGTCAGCTCGCGACCATAACACGTAGTCGGCTTTCGAGAAGTTACACACTGTT
CCGTTGGAGCGAGCCATGGCCGCGGTACAGCGTTGCTCTTGCTGGTCTCGGACCACACGATGCATGGCATGAGGGCTACGGCGTAGCTCCTCACTCAAAA
GACTCCTTCTCCAGCGGTAGTGTCCGAGGCAGCTTGTCATCGGGCAACACCACGACATCCAAAGGTGACGGCGCTGGAAGCCCCGTGAGCAGTTCCACCG
GAGCGCAGTTGCCCAGCGAAAGCACCGGACTGTGGTTCAAATTGGCTTGGATGAGAGGTAGGAGGTAGGCCCAATTGCGACTGTCAAGCTGGTTCTCAAG
CAGCATGGCCCTCAATACTCGCCGTATGTCGCGGTTGACCCTCTCCACTGTCCCGTTAATCCAAGGTGTGTACACCAGAACAAATGAATGGGATACTCCG
AGGCGCTCGGCGAGTTCCTCCATCACCAGGCACTTGAAGTGTGTGCCGTTGTCTGACATCCACACCGATGGGATGCCAAAACGCTTGTGCCAGTCCAGCA
CCGCCGCCACAGCCGTCTGGCTAATAGCCGAGTCAGCAGCAACGAGCTCACAGAAGTGAGTTAGCTCGTCCTTTAGGACAAGGACGTATTTTGGCCTCAC
CATAGCTTTCGCCGAGGTACAAGTAGTCCATGTGCATGCACTCGTTGCGTGAGGCAGCTGACCTGTCGACTGTCCAGTCGCGTTGGATGAGGGCACCGCC
TTTAACATGCTTGCACAGCAGGCACTCGTTTATCAAACTGATCACCACCTGCCGGGTCCCTGACAGCGTGAAGTGCCGATCCAGTAGCTCGACCATCACG
TGAATACCGCGGTGGCCCTGCATACCGCAGTGAGCAATCACGAGCAGGCGCTTTAAAAGCGTTTTCGCCTTTGACGGCACCCACAGCTTGCCGTCCGCGG
TAAGTGCGTCATCGCTCATCACAGCACCCGGTGGCGCATCCTGCTTGCACGAACGCTGTGTCGTAGCAATCTCGTCCCGAGTAGGCCACATGAACTCTCC
GTCCTGGAGTGGACGAAGCTCCGACAAAGTCTGCGCTGATCTGGAAGTCACGCGCTTGAATGCCACCGCCGAATCCGTAGGTTCTGGCGGAGGTTGCCCC
CAACGG