Description :
From Genome Similarity Track
Location :
Scaffold_10:115402- 117487
Transcript NameFunction/comments
Phymu_g803protein kinase

Sequence
2085 bases(100 bases per row)
TGTTCATTTCGCTGCTTGGGTTGTCCACCCCAACTCACTTTCGGTGCTAAGCTTGCCTCGTCTTTCCGGTGATCGTCATCGTTTGATAACCCACAGAAAC
ACGCGAGCACCAAGTTTTACTGCAAAACGCAAAAATTCAACAGCAAATTGCAAGAAAATTTTGGATTGCCTTTTTCTACAAGCTCGAAGTGCGTCAAAAC
TATCATGACAATAAATATTCAACGCGCCTCCCTATTTGTCCCCCTCAACGAGGCTTCAGTCTGTCGGAAGCCTCCCAATTCTATGAGTAAGCTCGCAAAA
ACGAGCAGGGGGCCATCATCATCGTTTGGCAGGCTTCTGCACAGCTCCAGGTTTGGCAGCTTGATGCAGGGAGCACACGTTGCCGTTGCGCTCGTATGCG
GGTTTACGACATCCTTCCACGACGCATCGCTTGCCTGGGTCATATCAAGTGATAAATAACAAGggcaggagaagaagctccgGCACGTAAGTACACACCG
CAGCCTACACAGCTACTTTACAGAGCTGAAAAAATGCTCaagacaagcagctcacCTCCTCCGTGAGCCCAGCAAAGACCATGCGAAACTGCTGTCTTGG
TGCAGTTTTCCTCGCTGCATTTGCGGCCTAAATCATAAAAAATTCGAGTAAGAAAACGTTGGAGAAATGGAAATGGGCACTTAAGTTCCGTACCTCCACC
GTGAGACCAACAAACCCCACGAGACTTTGCTCGGTTCTCACACCCCGCCACAGTACACTTAGTGGAGCCTCCTTGGAAATGTTACGCAACGTGTCAGAGC
AAATCATGAAGCCACCTTTTTCGGCAATCGCGCCATTCTTACCGTGCTTCCAGCACACGCCCAAATTTTTAGCACTGCTCGTGCACCCGACGACAGCGCA
GCGTTTGCCGCCCTGTTGATATCAGGTTGTGCGTTTGCACAGCACATGTTCAACCGTTAGATCCAAAGTGCAACACGAACGAAAGAGGAAAGGAAACCGC
AACTTACACCGTGGCCGATACAGAGTCCTCGGTTCACCACGTAGCGCGTGCAATTCTCAAACTTGCAGATTCGGGacttcttcactgtcgaCTTGGAGGG
AaccgctgctggtgccggCACATTGGCCTCTCGATTCTCCGAAGCGGCAACTCCCGAAGCAATCGCAAGGTCAGCTGCAACACGCACCAAGATGAAGCCA
GCAAACACGCGATCAGTCCGTGTCATCCACGGCTGCAACCTTTTGCAGTGCAAATCCAGGCATTCGTCTGCAACGTTGCAGTAATTGTCAGCGTAACGTA
CCGAAGCTTGCACCAGTCGCGTGAGCTTGGTCTTCGTCCGCGTTTCCACCCAAGATGAACGCGAGCGAGCTCTTGCTGGATGCCGCTGCACGTCCGACCA
GAGCCACCGCAGTAGCGTCCGTGTTCATGATGGCCGCTAGGTGGTGCCGGTTGGcagcgagctgcagcaccggcagcgGTCCAGCCTGCGCGTCCGACCG
GGGCTGGTCGTCAGCCGACGGAAGCCAGGCTGCGTtcatgtcgacgtcgtcggGGTTGGCCGAGTTCTTCATGCAGGGCGAGGGCTTGATAGGGTCAaag
agcagcatccaccGAGGCTGAGATAGGGAGCAAAGAGTACTCGACTGCGAGTGTATTTATATTCTAGCGGACGGAGCCCACAGACAGAGGACACCACGCC
ACACTACACGTGCACGGGGGCCAACTGTTCCGAACGGCAGCCGCTTGGTTGTTATCTGAATAATGGAGCGGGACCCACTTCGAGAACAGCTCAAGTCGCG
TCTGGATGGCGCCCAGAGACAAGCCCGCGCACCAAGGCTCGGGATGCGTTGATTGCTTTGTGCTGCGTCACCGAAGGAACCAGTGGTGAccgtgcagctc
ctgggGATCCGCTATACGGGCGCGCCACGGTACGCTTCCGGCTTGACGCTACACTTGGTGTTTGTAAGGTAAGACGGATGGCGGCCAAAATTGACGTCAT
TTCGGCCAATCGCCATGAGGAACCCATTTCGAGCTTCGAAATCCCACCCATAGTGGACCCAAGATGTTCCCGACTCGTCTCTTGA