Description :
From Genome Similarity Track
Location :
Scaffold_1173:1154- 5554
Transcript NameFunction/comments
Phymu_g12861helitron helicase-like protein
Phymu_g12862helitron helicase-like protein

Sequence
4400 bases(100 bases per row)
GAGCGAGAACTCAATCGAGAACGCCATAGAACGTTTAGGGAGCAACAAACGGAGGAAGAACGCGAGATGGAGCGCGAGCATGTTCGGCTACGCCGCTGCA
CCGTCCGCCATCGTGACGCACTCGCGAATCACGAAGATTTTCGCGCATCGATGGTTACAGGTACCGATGTCAGCCACGGACGCCACAGACTGCCTCCAAG
TACGGTCTGTGAGCACTTCAACGCGTGGAAGTGGCCAGGTGAGAGCAAGACAGCTTGCTGCCTTGAGGGAAAAATCAAGCTTTCTCCTTTggatccagca
cctccacggCTACTTCAACTTTACGGGGACGCCGAGTTTCGAAAGCACATACGGGCGTACAATCAGGTTTTTGCATTTACGTCGATCGGTGCATCCAGTC
CGGCTACGGGTAGGTTTCAACCGGTTAACCAGGACAACAGCGTGGCAGGCAGCCGCGGAGTGTACACCTACCGTATTCAAGGTGCCATGGGTCACTATAT
GGGTTCATTGCTTCCATATGTCGACCGTCAGACCGGCGAGAGGACCCAGCCCAACTTTGCGCAGATCCACATCGTTGATCCAGACATGCAGCGCCGCACA
GAGAGGCGCCGAGGGGTTTTCGCTGATTTGGATGGTgtagcgctgctggacatcgAGCCGATGATGCAAGAGCACAATCCATTCGCCTAGCAGTTCCTAA
CGTTTGGCGAGAGGGTGAGGCAGCATGATACTCAACAGCCCATCGACTTAGTGTTCCGCCTCCGAAACAATCCTTCCCGACCTGGGACGCACAACCTGCC
CACGGTGTCTGAGGTGACCGCGACAATGATTGAAGATGGCAACCTTGCACAGCCACGCGATGTATTGGTGTacaccaaaaacaaaaaccTCCTACGCCTC
TTGGAGACAAACGCCAACTACGACCCCCTTCAGTACCCGCTACTCCTTCCGTATGGAGAACTGGGGTGGACGTATACGGATACCTACGAGGGCAACGTAG
TGCGAAGAAACAAAGGTGCTATGACTCTACGGGAGCATGTGGCGTATCGTCTACTCCAGAAGGAAGATGACCAAGCAGCTCTACACCAAGGTGGACGTCT
ATTCCAGCAGTACTGCGTGGATCAGAGAGCCAAGTACGAACCATAGGAACTTCGGTGGATAGCAAGCCACCAGCAGGAGATTCGTGCTGACCAATACAAT
GGTCTTCGAGATGCGTACCTCCATGAAGCTATGGAATAGGCTAGGGTCATCCTGGGTGATGGCGAAGGACTACTGGCAGAGTTTGATCGGGAGGCTGGTG
AGTTGGCTCATCCCGATCGAGCTAGAAACACACACTTCCTCAATCAAGTCGGGAAGTAGGTGATCCTTCCGTCTTCTCATTCAGGGGGCCTACGCCAGAT
GTACCGGTCGTACCAAGACTCCATGGCTATTGTCAGGGAGTACGGCAAGCCAAACGTCTTCGATACGATGACCTGCAATCCTACGTGGGAAGAGATCCAG
GAAAAGATCCCCGATGCAAACCAGAGTGCCCAAGACCGCCCAGACATCGTCGAGAGGGTATGGCAGCAAAAGCTGGCTGCTCATATAAAAGACTTGGACG
AAGGAGTGCTCGGACGGGTTGCAGCTCGGATTTACGTTGTGGAGTTTCAAAAGCGGGGACTCCCACATGCTCACATCTTAGTCATCTTagctgaagagga
caagCCACACACGAGACAGATTATTGACAAGATGGTGTCTGCTGAAATTCCGGACCCTACGACTAATCCGGGCCTTTTCGAAACGGTCATGACGTGCCTG
ATGCACGGTCCCTGTGGTGCGGCGAACCCAACGTGCGCCTGCATGAAGGATGGCAAGTGTACAAAAGGTTATCCCAAGCCGTTGGCGGAGGCGACGCGAG
CGAATGCAGACGGATTCCCACAGTacagacgtcgacgccgtccagAGGGAATTCTCACGTTCAACGGAAAAGAGTACGACAACACCACGGTGAATCAGTG
GGTGGTTCCGTACAACCCCTACTTTTCCCAAAAGTACGATTGCGACATCAACGTGGAAATTTGGACGGCGCTCTCAGTGGTGAAGTACCTGTACAAGTAC
GTCTACAAGGGATCCGACAGGGCGGTAATTACGGTGGAGACGGTACAAGGCGAAGATAATATTGACAGACGAGAGCAGAACGAGATTATTCGATTCTTAA
GCGCGAGGTACATTTCACCAGTAGAGGCGTGTATGCGTCTCCTCGGCCATGTCGTCCAGGGGAAGACTCATTCCGTTGTTCAGCTAACGGTGCACCTCGA
TGACCAACAGATGGTGGTTTTCAGGGCGACAGAAGACCCGGAGCGCGTCATTGACCGTAGTGAGCGCACAATGCTTACTGCCTTCTTCGAGGTATGCGCG
AGCGTCGAACCCGAGGACCAAGTGGCGAAGACAATTGTGTACCAAGACATGCCCAAGCACTTCAAGTGGGTcgccaagggcaagaaaTGGATCCGCCGCA
AAAAGTACCAAGCTGCGCTAGGACGCATGGTGCACGTCTCTCCAAGAGATGAAGAGAGGTTCTACTTACGCGTGTTGCTGTGTCATCGCAAGGGCCCCAC
GTCTTTTCTGGATCTACGGACTGTGGGCACGGACGATGGCGCCGTCTGTACAACATACAAAGACGCAGCAGTACGTTTGGGGTATCTTGAGAATGACGCG
GAGTGGGCTGCCTGTATGGAGGAAGCCGCGACTTTTCAGATGGCCTACCAACTACGCCAGCTTTTCGCAACACTTTTGGTATACTCCCAGGTTGCTCAGG
TGCGTCAGCTGTGGGATGATTACTACGAGGCATTGTCCGACGACTTCAACCACCGGTTCCGGGCTATTGAAGGTGAGGCGAAGGACAAGTTGGTGATGTT
TAATACGCTCAAGAGCCTCGACGAATTGCTTCAAGTGAGTGGGAAAGCGGTAGCTGAGTTCGATCTGCCACAACTTCACGAGTTCCCAGATCTACTTCTT
CGGGATGCGCTACAGGCCGAAAATAGTCTTATTGCTCGCGAGAGTGCGGCTTATGACTACGATATGCTTCATGACATTTTGGAGCAGGAAAATCATCTCA
ACGAAGGCCAACAGGCAGTTTACGCAAAAGTCACGGCAGCTGTCGATGATTCTTCGGCTGGCAACAAGCTGTTCTTTGTGGACGGACCGGGAGAGACGGG
AAAATCAACGTTGCTCAAGGACATCCTCGCTAAAGTGCGTCTGTCTGGAAAGATTGCCATCGCGGTGGCGTCAAGCGGAATTGCAGCGCTCCTGTTAATG
GGCGGTCGCACAACGCATTCCACCTTCCGTATCCCGTTAAAACGGAATGCTGAGTCTACTTGCTCGATCAACAAGCAGTCTTCTTTGAAGGAGCTTATCA
AGAAGGCCAGCTTGATCATCTGGGACGAAGCTCCGATGACCCATCGCCACGCATTCGAAGCTGTTGATCGTTCCCTACGTGATATCCTGAACAACGCGGA
AGAACCGTTTGGAGGGAAAGTATTCGTGCGTTCGGGTGATTTCAGACAGATTCTTCCGGTGGTAGTGCAGGGAACCCCGGCGGATACAATCGACGCGTGT
CTTAAGTCATCGGGGTTGTGGAGCAAGTTTGAACAAGTTCATCTTACGGAGAACATGCGCGTGAGGTCTGCTGCAAACGAGaccactgcagaagaacttg
cagctttctccGACTTTCTCCTTCAAGTAGGCGAAGGAAGACATGAAGTGAACCATGAGCTTGGCTCAGACTTCATCAAGATTCCGACCGGTATGTTAAT
CGAGAACCAGCCCGAAGAGGAacccgaggaagacgaagagatcgGACCTGGTGCCATACCCAGAGGCTTGCGGCGTATCATTGAGGAGATGTACTCAGAC
ATCAACAACCCTGAGGTCGCCACGGACGAGTATTTCGCTAACCGCACGATTTTGACGACAACGAACATGGTGGTTCAGCGTATCAACGAAGCTGTATCGC
GGAAGCTGGACGGAGAGGCCCAAGAGTATTTGTCAAACGATTCTgtggatgacgacggagatgTTGATTACTTCGAGCCCGAGATCCTGCATTCTGTGAA
TATGAACGGAATCCCGCCGCACAAGCTAACTTTGAAGAAAGGGGCGCCGATTATGATGATGCGGAACTTGAACCCCAATCTAGGACTGTGCAAGGAACGC
GTCTTCGTGTTGTCGACCTGAAACCACATGTCATCCACGAGACCATCATGACAGGCGAGCGCCATGGACAACATGTGCTCATCCTGAGGATTGTGTTCAT
CAGTGACGAAGCGCACGACTTCCCCTTCCGTCTTCGCCGTAAGCAGTTTCCGGTGCAACCAGCGTTTGCCATGACGATCAACAAGGCCCAAGGACAAACG