Description :
From Genome Similarity Track
Location :
Scaffold_1755:1154- 2596
Sequence
1442 bases(100 bases per row)
CGCCTTTGCTCATAAGATGGGGTGCTGCATTGACGAAAGGCAGACATTGGAGTGTGAAGGCGTTGGAAAATCTCCAGACATGGCGGAAGGACGCGCACGG
GTCAAGATCACGCTCGCTGGATCACTCGTGTATTTATTCGATGTGTGGGTGGGTCCGCCGACCGGCGGTCAGGACTTAATCCTCGGCATGGACTTTATGG
TACCGGCGGGTATTCTCCTCGATCTTGCCGACGGAACAATCTGCCTGCCGGACGAGGTGCGGATCCAGCTCGCAGGAAGATGTCCGCTCTACGGAGACAA
GGTGGAACAGGTGACTTTGACCGGTCATCGCGAGATCGACATCGCGGGATCCGCTGAGGTGAATCTGCGCACAAGATCAACGGAGCATCAGAAACGCTGG
GTTACGCGCGGTGATTGATGGGTCCCTACTGTGACTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAACTAGGAT