Description :
From Genome Similarity Track
Location :
contig_31:115395- 116597
Transcript NameFunction/comments
g7466.t1hypothetical protein

Sequence
1202 bases(100 bases per row)
CGGATTGCGCACGATCCGAGGCACTTGAGTCCCAAGTTGAGACGCTTCCACACACGATTTCGGCGGTCTTTGTTAAACGGCTGGAGACTTCGCTTGCTCA
TGCAATCGCTGCTGTGTGGTCTCCGACGCGTGCTTCAGAGTTCGCGACTTCTAGTCCAGGAGGCTGGGGCAGGTGACCTGGAAGCGATGAGCTCCATAGT
GCCAGCAAGGAAGGACAACGGTGGAGGAACAGCTATCCGCCTCGAAGGTGTTGGAGTTGAAGTCGGTATTGCGCATGTGGACGCCTGAGGGAGTGATGTG
CTAGGTGGAGTGGACAGTGCCATCAGTGAAGCTGTTGGCGATGAGAACGACATGCCGTGTGGTATTGAGCACGTCGGCTGTAGGGCTCTTTTTCGTCTCT
CGGTTTCTAGTGCTTCATGCAAGCGGAGGCTCGTGGCTGTATATGCGCACTGCCGACTCCTTGGGAGCAGTTGCTCAGCTAAGTTCTTCATACTGAGGAA
CTTGTTCGTTACCGGCGACGACGCAGAGGCCTAGGCACCCATAGCCTGAGACCCAGCAACATCCTCTACAGTCAAGAAGGAGAGGAAGGTGATAGAGCGT
GGCACAAGGGGAATGATGTCGCTGTGGAGCAGAGCTAACTGCTCGCGTGAAGGTTGTATAAGGGACCTTCGTTCAAGTGTACTGTTCGTGGGGGACGCGT
CTGCCGCTCTCATCCGGGTTGCACGAAGACGTCTTGGGCTGGGAGGTCAGCGTTCCATGGTCGTGTCCAGGATGCAGGAAACATGTCGTAGAATGAATTT
CAAGTCGGTGTTGCGAAGACGGTGGAGACAATCAGTGCGAGTACATATATGCAGATTGTACCAAGCAATTATTGGATAGAGCCGTCCCCATTTGCTTCAC
TCATGGTGGAGGGTTTCAATACGCATCCGTGGTGTAGTCCACAATGTCTGGCAACGGCGTGGTCGAAGAGGGGTCAACTTGATCGAGTGGAGCATTGAAA
GCGAGAATGGAGACAGGTTACCAAGTCTCGTTCTGGGAATTTGCAGGTCAGGGAAAGCATCGAGCGCCGCCCACCCTATTTTACCTTCTCGAACGCTCTA
CGTGTGCATCAATCTTGACCGCTATCCTACCATAAGCAGCAACCGACCAAACCGTTGATTATGGCTTGATGGATGCGCTTGCAGAAATGCAGGTCGTGAT
CG