Description :
From Genome Similarity Track
Location :
Scaffold_15:115378- 121043
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_05159Hypothetical protein
Sappa_CBS223.65SPRG_05160zinc-finger containing protein, partial
Sappa_CBS223.65SPRG_05161urease accessory protein ureG putative
Sappa_CBS223.65SPRG_05162Hypothetical protein
Sappa_CBS223.65SPRG_22158Hypothetical protein

Sequence
5665 bases(100 bases per row)
CGTCTGTTCTTGGGCCATCGTCGCCAAGATCGACGCGATGCGGTCCTCCGCCGACGCCGCCTCTCTTGCGTCTTCGCTACTGTGGTCCCTCTGGTCGTAC
GCGATCTCTGCCAAGATGCGTCCGAGCGAAACCACTGCGCGGGCCGCACGTTGGCGGTCCTCCGAGCCCAGCAGCGCGCCGGACGAGCCCACGACGAGCC
CTAGCAGCGCCACGCGGAGCCAGTATCGCGTCGGGCCTCTTCGTTGGCCATCTATATCTCTCTGGAAGGACGAGAACTGCCGCAAGCGTCGCGGCGCGAC
GGCGCGGGTCCGTCCGAGGCGGACCATCGGCCGTGCCCATCGGCGCAAAGACATCGCTGATGGCTTATTGGCTTCGAACTTCGATCCGAAGCAATCGAAG
ATAGGTCCGGGAATGTTCCGGTAGCCTGTCCACGCACTTCGAATTCGAAGTCGCAGCGAGCCGCCGCTTCTTTTTCGACTCGAAAGTCCGAAATGGAGCC
TAAAGGAAGCCTGATTTAAGGGCAGAATAGCAGGGCCGTCGATTGGGTGCACGTTTCTTATGCACGACAGTACAATAAGAATACAATTGAGAAGTATCAT
TTTACCAATATTAATATTACGGTGATGTTCTTGTGGTGTGCGACAATACTACCTACGTGTTCACTGGCTTTTTATTAAAATACACGTTGACCACGTATCC
AATTTATAAAAAACCGTGCCGACTCGTATAATAAAATGGGTATTAATAATAAAAGGTTCCATCGGCTTCTGCGCAGAAAACTCCCGGCGCCTTCGAACGC
GTCGCGTATTTTATTACAATTCGGACGTTCAACTTTTTTTAATTTCAGCGCACGCACATCGGTTCGGAATCCGCCGATCCTCGTCGCGCGTCTCTGTTTT
TAATGCACCTAATCTTTGTATGGGACCATCGTATTATTATACTGGCGCCGCTCCGGGGTTTTCTTTGTTGCTCACACCGGCCCGACTTCAAATAAAACGC
AATTAAATTTAGCGCACTCCGTATACAGCCGCCCATACAAACACCAGCTGGGAGTTTTACGGCCAGCTCCGCCCATTTTCATTTCCGCTTTTGATCCGTC
GCTCATGCAGAACTCCTCTGGCATCCTCCCGACGAGCTCGTCCTCGACGCCGGCCGCCGAGCCCGCGCCGGTCGGCCCTGCCCTGGAGCGATGCCACGCC
CTGACGCCGGAAGCGCCCAAGCCACTGGCCAAGGCCGTCGAGGTGACCCCGCTCGAAGCGGCAACCGCGCTCGCGACCGAGACGCCGCAGGAGCCCGAGA
AGCCGTCCAAGGTTGAGCAGTCGAACAAGCGCAAGTGCTGGTCGTGCAAAGCCAAGATTGGTCTCTCTGCGATCACGTGCCGCTGCGGCTACACGTTTTG
CACGCGCCACCGGTACGCCGAGGAGCACAACTGCACATTCGACTTTCGGCGCCAGGCCAAGCGCAAGCTGGAGGAAGAGAACCCGCTCGTCGTGCCCATG
AAGGTTGCACGCATCAACTAGACGACCCGTACCATATAGAGTTAGGACCACCCCGTAGATTACCAGGAACGAATTTACAAATTAAGATTATATATTCAAT
TCGACCGTGCGATCTCTGCCTTCTGCTGTCGAAGCTGCGTCTTGCCCGCATGGATGGGCGTGATGAACAGGCGTAACGAGGCCGTGTGCGTGTACCGAGG
CAGAGAAGAGCGGGCAGACCAGGTGGAGAGACATACCGGTGCGTCCCAAGCAGCCGATGTGGATGAGCCCGAACTGGACTCGCGTTGAACTAGGCAGAAT
CAGTTTCGTCGGGTCGGCAATCTTAGTCGATTAGTCGACTAGTTCTTAGTGGTTTAGTCATCAAGTCGTTTAGTCATCAAGTCGCTCAGTCGATCGAACC
AGATTGCGCGACTTGCCAGCTGCTGGCTGCTTCGCCAACTGTCCGATCTTCGTCAAGGCCGATCTTCGTCAAAGCCGATCTTCGTCCCAAGTACAGAGCG
ATGTCCAGCCACGCCCCCGCTGACCACCACCACGACCACGGCCACCACCATGACCATGACCACCACCACCATAACCACGACCACCACCATGACCACCACC
ACCACGATCATGACCATGGGCATGACGATCTAGGGGCGTCGGAGACGGTCGAACGCTTCAAGAAGCGGTATGGCCGCGACCCGACGCCGAGCGAGTACCA
GCAGCTCATGGACCATGGCCACACGCACGAGCACCTCGAGCATGCGGGTGTCTTTGAGCACCGCGAACCGCTCATCGAGCGCGACTACCTCGAACGCGCG
TTCACCGTTGGCATTGGCGGGCCCGTGGGCAGCGGGTATGGTTCCTCTCAATCCCGCGCCTCCTTCATCCTCGCCACGTAGAAAGACAGCGCTTATGCTT
GCGCTCTGCGAAGCCCTTCGCGATCGGCTCCAGATTGCAGCGGTGGGCTTGGCTCATTCTCTCCTGGCGCGTCATGGCTGCGTCGGCGTAGGTGACGAAC
GATATCTTTACCAAAGAAGATGGCGAGTTCCTCGTCAAGCACAAGGCGCTGCCGGAAGAGCGCATTCGGGCCGTCGAGACGGGTGGCTGCCCCCATGCTG
CGATCCGCGAAGACATTTCGGCCAACCTCCAAGCCTGCGAAGAGCTCACGGACCTCTTCCAGCTCCAGCTCGTGCTCGTCGAGTCGGGTGGCGACAACCT
CGCCGCTAACTTTAGCCGCGAGCTCGCCGACTACATCATCTACGTGATCGACGTGGCCGGTGGCGACAAGGTGCCCCGTAAGGGCGGCCCTGGCATCACG
CAGGCCGACCTCCTCGTAACGGACCGCCGCCTGGAGCCATCCCCTCATGTGTGCTCCATGAATTAGGTCATCAACAAGATTGACCTCGCGCCGCATGTGG
GCGCGAGCCTCGACGTGATGGCGCGCGACGCCAAGCTCATGCGCGGCGCGGGCCCCACGGTCTTTGCGCAGGTGACCGGGCGCGTGGCCGTCCAGGAGAT
CGTCGACCACGTTGTCGACGCGTACGAACGTAAGCATCTCTCGCATTGAGGAAATTACATCGTCTCTACCGCATCATAATGTCATCGTCCGAGCCGTACC
CGTTGTTGTTGTCCAAGTCGTTGTACACGGGGGCGCTGTCGACCTCGGGCTCGGCGTCGTCAAAGTTTGCAAGGCAGTCCATCGTCGATACCTCCTTCTT
GCTCCGTCCTAGTACCGCTTTCTTGGGCTTGGTGGTCTATTGCCAGTCAACTACGTCGGTGGTCGGTGGAGAAGGCTTACGACTGCAACGGGAATATTGT
TGGGCTTGGGCGGAGGCGCAGAGGTCTTGGTCGACGGGCGCTTGGCAGGTCCGGGCGCAGGGACAGGTGTAGGCTTGAGCGACGATACCTTGCCCGACGC
CTTTGGCTCGTCGCTGGGTCGAGGATGACTCGCTTGCGTGGGTTTTGTCGCGAGAGGTCCTCTCAGCGTCGATGGTTTGGGCTTGATGGCTGCCAGCGTC
GCCTTGGGGCTCTCGGTGACAGGCTTTTTCGCAGCTGGACCTCGCCCGTTGCTGGACGTCGTCGACGACGACGACGTTGGGCGCTCTTGGTTGGTTGGTG
GTTGCTTGGGTGGCGGTTTGAGACTGGGCAGTTTGAAACTCGATGCTCCTCCTCCCGAGAGGTCCATCGGGGGCCGCGGCTTCTGCGCACTCTCAGATAA
GCACTTGGTGTTCGGTTTACCTTGATGTCGAGGAGGCCGCGGTGAACTCGAGCTCGTTCTTGGCTGCGGCTTCTTGCTGCACGAGGTCGCTCTTCGCCGC
CTGGACGAGCTCGTTGAAGCCGGCAACGTCCATTTCGGTTCTAGATTTGCATCGGCGCATGCGCCTGCGCCTTGGGCGGTCGTTGTACGTACTTTTCGGG
GGCGGCCGGCGCCTTCTGGTGCAGGCGCATGCGGCGGACAACAGCCTTGGCGTCCATCTCGGTCTCGACGTGCACGAGCGGCAGCTTCTCTAGAAACATA
TTCCTCCAACGCTATTCATAGCAACTCGGTCGATCCACACCAAACACACACTTTACACGCGAGCTTTATACACGTCGCTTAGCCTTACGCCGAGGGCTTA
CGGGAAGACGCAGCCGTTGACGCCACGCGCAACCATTTGGCAGACCGCGTCCGCCGGCGCGACGCACGAGCCCGCGCTGTGGAAGCTCGGGATCCCCGAG
ACGCAGTCGCTCGCCGCCTTGTCACCCTTCTTGGGGCAATTGCTACCATTGCCGCCGCAGATGGGCCCCGGCACGCAGTACGTGGCGTCACCTGCGACGC
TCACCGGAATGCACGCCGCATTCGCGTTCGCTTCAGCCGCCGCCTTCTTCTTGTCAAAGACGCAGCCGCGGACATGGGGCGCGATCGTCTCGCAGGTCGC
ATCCATTGGCGCGACGCACTTGTCGGCGCTAACGTAGCTGTCGAGGCCCTTGAGGCAGTGGGCAGTGGCCACATCGCCCTTCTTCGGGCACCCACCATGC
TCGCCACCGCACACTGGGCCCTCGATGCAATATGTGGCATCGGCAACAATACTGATCATGGAGCACTTGCTCGACGGCGCACTCGGGGTCGACGTCTTGG
CGGCTGCCGTCGTCGAAGGCAGCACGGTGCCATTGTTGTGGACCGGTGCCGTCGTCGCCGGCGTCGAAGCGTTCGTCGGCGTCACGGACGGTGTGGTGGG
TGTAGAGGTTCGGACGGGAACAGCCGTTCCGTTCGAAGACGGGGCCGGGGTCGGCGACGCCGAATCCTTCGTCGTCGGCGCCGGCGTCGAGGCGGTCGGC
GTCGGGGTCGACGAGCTACCTGTGGTGGGCGCCGGTGCCGTGGTGCTACTTTGCGTCGATGTAGGGGCGTTCGTCGTCGGAGCATTCGTGGGCGCCGTCG
TCGGAGCCGCTGTGCTCGGCGATGGGGACGGAGAGGGCCCTGCAGTCGAAGGGCTCGGAGTCGCCGGCGCGGTCGTAGGCGCGGTCGTCGGCGCAGTCGT
AGGCGCGGTCGTCGGCGCGGTCGTGGGGGCCGACGTAGGAGCCGGCGTCGAGGCGGCAGCAGTCGTTGGCGCCGGCGTTGTTGCTGGCGACCGGTCGCAC
ACCAACGCATCGGCCTGGCACTTTTGGAACACGGGCGTGCCGCATTCGTCCGAGGTCTTGGCCTTGCGGCAGACGTTGGCGCACATGTAGCCCGGCGACG
TGCTGCCGCAAGTGCAGAACATGCTGCAGTCGTTCGCGGCGTCTTCCGTGTTGCACGCTTTGAGGCAAAAGTCGTTCGTGCGGGCGTCGCTGTTGGCGAC
ACACACCTTGGCCGTGCACGTCACGAGCTGGCCGGACGAGGACGCGGCGAGAAGCGCCAGGATGGCGAGGACGTGAGGTACTGCGCGCATGAGGCACGAG
CAGTCGAATTGGAGAAATGGGCTGCGCGCGACGATCCCGCCCACGTTACATGCCTCCTGTCTGGCTATCCACGGTGTGACACGCTCCGCATGTCCTTGAG
GTTAGAAAAAGCCTCGGTCGCCTCTACCACTCCTCCCGCGCTGTGGAACCCGCCACCCGGCCGCTGGTTGCACTCACACGCCACTTTCACAAGCACGCGC
GATTGCTCACAGGCAACGCCAAGTGGCCGCGCGGAACGCTACACTATTACACGGGCGCCCACCTC