Description :
From Genome Similarity Track
Location :
contig_77:115376- 118392
Transcript NameFunction/comments
g12491.t1hypothetical protein
g12492.t1XP_009846822.1 hypothetical protein H257_19374 [Aphanomyces astaci

Sequence
3016 bases(100 bases per row)
TCGCACAGCTCCCACTGCTTCACCGACGTCATGTCGATGCCAACACCGTAGCTCTTCTTGACGATGGCGTCTAGACCGCCATGGCCAATGTGACCAAGTC
GGAGGTGCCAGAGGTACGACGTGGTGTCCCCTTGGCGATCCTTCGAACTTGCCGCATTGGCCTCGTCAGGCATCATCGGAGTCATGCACAGCTTGAACAG
CCCTTTGCCCTCACGAGCGCCGAGCTGCCACTTGAGACCCTTGTTGTCCGCGAAGCACCCGTCGCTCTCGAAGGTCACTGGCCCGACGTCCTTGGTGAAG
CGGCCGACCGAAAACAGGTTGCGCGACAGCTTCGGGATATGCCACACATTCGTGAGCACACCCTTCTTCATGCCGCGCGGCGTCTTCATCGACATGACAA
TGTCGCCGGTCCCCACCGCCTGAACCACACCGTCGTCCGCGAGATGCACGTCCACCGGAGCCATCTTCTTGTAGTTCCTCATGTACTTGGAACTCGTCAT
GTGCTGCGTCGCACCCGAGTCGACCAGCCACATGTCACTCGGCTTGGCAGTACTGCTCGTACGACCAACCGAGAAAAGGTAGTCGCCAGGATCTTCTTCG
TCCTGCGCGACGTTCGCACGCTGCGACCGATATCGCTCAGCGTCGTTTGGACCCGCGAGGACACTCCGCGATCCAATGTCCTTGTTTGCCGCAGTTGTGG
CACGCCCCGGTCTTCTTCACCGGTCGGCCCTTGCGCTTGTTGTCTCTCGTCATGAACGCTTGACCTTGGCCGTGCGCGGCTCCGTCGACGCCGCCACAAA
AGGCTTTGGTCGGTTGATGGCAAAATGCAAAGTGATTGATTTAGGTCCTTAGTTCGCAAACTCCCTTGCTACCTCTAAGCCTACTGGATTCTCTACTGGA
TACACTCTACTGGATTCCTTACCGGATACTGAGTTGCTTCAGCCAGTCAGCGACTGCCACGTGGATGCCCATCTTGTACCCACAATCTTGTACCCACGTG
TCCCGTAATCCCCGTAGCGTAAACAGCGTCCCATCATCAGTGTCCCGCGTCCCATCATCAGCGTCCCGTCAACACAGGAATGATTGCGGTCCCACTAAGT
GAAGGTCATACCGGTATCCTACCGGTATACGGCAGCTGCCCGAGGCGCCTTCTTGACAACAAGCAGCAACGACGAGCTGTTGGAATTGACCAAGCACGCG
TTGAGCAAGCGGTTTGAGATGACGGACCTCGGCGAGCTGGAGTATTTCCTCGGGATGGAGATCAAGAACGACCACGGCTCCGGAAAAGTGACGGTGCGGC
AGACCAAGTTTCTCAAGTCCATCCTGACCAAGTTCGGCATGCAAGACAGCAAGCCTGTGAAGACGCCGCAAGACCCCGGACTCAAGCTGACCAAGAACAT
GTGTGAGGGTGGCTGCCAGCATGAAGACATGATGAAGAACGTGCCGTATCGGAGTGCCGTCGGTGCTCTCGTGTACTTGATGGTGGCAACGCGTCCGGAC
CTCGCTGCTGCAGTGGGAGTGCTGAGCCAGTTCTCTGCCGACCCGTGTCCGACGCATTGGCAAGCCCTCAAGCGTGTGCTGCGGTACCTCCAAGCGACGC
CTACGCATGGACTCGAGTTCTCACGGGAAGACAGCCTTGGTATGTGCGGATATTCGGATGCGGACTGGGCCGGCGACATCGAGTCAAGACGGAGCACAAG
CGGCTACGCGTTCATGATGAACGGCGGATGCATCAGCTGGAGGAGCAAGAAGCAGCGGACGGTGCGCTGTCTTCAACGGAGGCAGAGTACATGGCGCTAT
CGGAGGCAACACAAGAGGCAGTGTGGCTCAAGGTGTTCCTGTGCGAGCTCGGCGAGATGGCAAGCGATGAAGCGGTCAAGATCTACGAGGACAACCAAGG
CTCCATCGCGTTGGCCAAGAACCCGCAGTTCCACAAGCGCACCAAGCACATCGACATTCGCTACCACTTCGTGCGCGAGAAGATGGAAGACGGTCAAGTG
GTGCTGCAGTATGTTTCGACAACCGACATGCTGGCGGACATGATGACGAAGGCGATCACTGCGGTGCAGTTCAGTGTGCTTCGGACCAAGCTCGGGATCC
AAGGTGCAATCGCTGTCGAGTCGAGTGGGAGTGTTGTCAAGAAGGCGCCTCGGGCAGCTGCGGGATACCGGTAGGATACCAGTATGACCTTCACTCAGTG
GGACCGCAATCATTCCTGTGTTGACGGGACACTGATGATGGGACGCGGGACACTGATGATGGGACGCGGGACACTGATGATGGGACGCTGTTTACGCTAC
GGGGATTACGGGACACGTGGGTACAAGATTGTGGGTACAAGATGGGATCCACGTGGCAGTCGCTGATTGGCTGAAGCAACTCAGTATCCGGTAAGGAATC
CAGTAGAGTGTATCCAGTAGAGAATCCAGTAGGCTTAGAGGTAGCAAGGGAGTTTGCGAACTAAGGACCTAAATCAATCACTTTGCATTTTGCCATCAAG
CGACCAAGCCTTTTTTGACTGCCTGGAATTGGTGAAGGCCATCTACGGTCTCAAGCAAGCTTCGCGCGTGTGGAACGAGACCTATGACGAGTTCATGTGC
TCTATCAGTTTCCAAGTGTCGGCCTTCGATCCGTGCCTCTACATCAAGGTGGTGGACGGTCAGTGCGTGCTCGTGCTGGTGTACGTGGACGACGTGCTGA
TTACCGGGAGTTCACACGAGCTGATCGCACGGACGAAGACGGACCTGAAGACGCGCTTCGAGATGACCGACAGCGGCAAGTGCGCGTTTGTTCTTGGGAT
CGAGCTGGTGGACGGCCCGGACGGCAGCGTGACCATGTGCCAGCGTCGCTACGTGGACGACATCCTGAAACGCTTCGCCATGGACGAGTGCAAGGCTGTG
GTGAGTCCGGTGGACATGAGCACTCGACTGGTTCCAAGCGACGCGGCGACCAAGGTGAACGCTCCGTTTCGCGAAGCTGTTGGTGCGCTGATGCACCTGA
TGACCGCCACGCGCCG