Description :
From Genome Similarity Track
Location :
contig_77:115376- 118392
Transcript NameFunction/comments
g11938.t1POM77273.1 Integrase catalytic core protein [Phytophthora palmivora var. palmivora
g11939.t1XP_009846822.1 hypothetical protein H257_19374 [Aphanomyces astaci

Sequence
3016 bases(100 bases per row)
CCGTCGCACAGCTCCCACTGCTTCACCGACGTCATGTCGATGCCAACACCGTAGCTCTTCTTGACGATGGCGTCTAGACCGCCATGGCCAATGTGACCAA
GTCGGAGGTGCCAGAGGTACGACGTGGTGTCCCCTTGGCGATCCTTCGAACTTGCCGCATTGGCCTCGTCAGGCATCATCGGAGTCATGCACAGCTTGAA
CAGCCCTTTGCCCTCACGAGCGCCGAGCTGCCACTTGAGACCCTTGTTGTCCGCGAAGCACCCGTCGCTCTCGAAGGTCACTGGCCCGACGTCCTTGGTG
AAGCGGCCGACCGAAAACAGGTTGCGCGACAGCTTCGGGATATGCCACACATTCGTGAGCACACCCTTCTTCATGCCGCGCGGCGTCTTCATCGACATGA
CAATGTCGCCGGTCCCCACCGCCTGAACCACACCGTCGTCCGCGAGATGCACGTCCACCGGAGCCATCGTCTTGTAGTTCCTCATGTACTTGTTGGAACT
CGTCATGTGCTGCGTCGCTCCCGAGTCGACCAGCCACATGTCACTCGGCTTGGCGGTACTGCTCGTACGACCAACCGAGAAAAGGTAGTCGCCAGGATCT
TCTTCGTCCTGCGCGACGTTCGCACGCTGCGACCGATATCGCTCAGCGTCGTTGTGGACCCGCGAGGACACTCCGCGATCCAATGTCCTTGTTTGCCGCA
GTTGTGGCACGCCCCGGTCTTCTTCACCGGTCGGCCCTTGCGCTTGTTGTCTCTCATCATGTACGCTTGACCTTGGCCGTGCGCGGCTCCGTCGACGCCG
CCACAAAAGGCTTTGGTCGGTTGATGGCAAAATGCAAAGTGATTGATTTAGGTCCTTAGTTCGCAAACTCCCTTGCTACCTCTAAGCCTACTGGATTCTC
TACTGGATACACTCTACTGGATTCCTTACCGGATACTGAGTTGCTTCAGCCAGTCAGCGACTGCCACGTGGATGCCCATCTTGTACCCACAATCTTGTAC
CCACGTGTCCCGTAATCTCCGTAGCGTAAACAGCGTCCCATCATCAGTGTCCCGCGTCCCATCATCAGCGTCCCGTCAACACAGGAATGATTGCGGTCCC
ACTAAGTGAAGGTCATACCGGTATCCTACCGGTATACGGCAGCTGCCCGAGGCGCCTTCTTGACAACAAGCAGCAACGACGAGCTGTTGGAATTGACCAA
GCACGCGTTGAGCAAGCGGTTTGAGATGACGGACCTCGGCGAGCTGGAGTATTTCCTCGGGATGGAGATCAAGAACGACCACGGCTCCGGAAAAGTGACG
GTGCGGCAGACCAAGTTTCTCAAGTCCATCCTGACCAAGTTCGGCATGCAAGACAGCAAGCCTGTGAAGACGCCGCAAGACCCCGGACTCAAGCTGACCA
AGAACATGTGTGAGGGTGGCTGCCAGCATGAAGACATGATGAAGAACGTGCCGTATCGGAGTGCCGTCGGTGCTCTCGTGTACTTGATGGTGGCAACGCG
TCCGGACCTCGCTGCTGCAGTGGGAGTGCTGAGCCAGTTCTCTGCCGACCCGTGTCCGACGCATTGGCAAGCCCTCAAGCGTGTGCTGCGGTACCTCCAA
GCGACGCCTACGCATGGACTCGAGTTCTCACGGGAAGACAGCCTTGGTATGTGCGGATATTCGGATGCGGACTGGGCCGGCGACATCGAGTCAAGACGGA
GCACAAGCGGCTACGCGTTCATGATGAACGGCGGATGCATCAGCTGGAGGAGCAAGAAGCAGCGGACGGTGCGCTGTCTTCAACGGAGGCAGAGTACATG
GCGCTATCGGAGGCAACACAAGAGGCAGTGTGGCTCAAGGTGTTCCTGTGCGAGCTCGGCGAGATGGCAAGCGATGAAGCGGTCAAGATCTACGAGGACA
ACCAAGGCCCCATCGCGTTGGCCAAGAACCCGCAGTTCCACAAGCGCACCAAGCACATCGACATTCGCTACCACTTCGTGCGCGAGAAGGTGGAAGACGG
TCAAGTGGTGCTGCAGTATGTTTCGACAACCGACATGCTGGCGGACATGATGACGAAGGCGATCACTGCGGTGCAGTTCAGTGTGCTTCGGAGCAAGCTC
GGGATCCAAGGTGCAATCGCTGTCGAGTCGAGTGGGAGTGTTGTCAAGAAGGCGCCTCGGGCAGCTGCGGGATACCGGTAGGATACCAGTATGACCTTCA
CTCAGTGGGACCGCAATCATTCCTGTGTTGACGGGACACTGATGATGGGACGCGGGACACTGATGATGGGACGCGGGACACTGATGATGGGACGCTGTTT
ACGCTACGGGGATTACGGGACACGTGGGTACAAGATTGTGGGTACAAGATGGGATCCACGTGGCAGTCGCTGATTGGCTGAAGCAACTCAGTATCCGGTA
AGGAATCCAGTAGAGTGTATCCAGTAGAGAATCCAGTAGGCTTAGAGGTAGCAACGGAGTTTGCGAACTAAGGACCTAAATCAATCACTTTGCATTTTGC
CATCAAGCGACCAAGCCTTTTTTGACTGCCTGGAATTGGTGAAGGCCATCTACGGTCTCAAGCAAGCTTCGCGCGTGTGGAACGAGACCTATGACGAGTT
CATGTGCTCTATCAGTTTCCAAGTGTCGGCCTTCGATCCGTGCCTCTACATCAAGGTGGTGGACGGTCAGTGCGTGCTCGTGCTGGTGTACGTGGACGAC
GTGCTGATTACCGGGAGTTCACACGAGCTGATCGCACGGACGAAGACGGACCTGAAGACGCGCTTCGAGATGACCGACAGCGGCAAGTGCGCGTTTGTTC
TTGGGATCGAGCTGGTGGACGGCCCGGACGGCAGCGTGACCATGTGCCAGCGTCGCTACGTGGACGACATCCTGAAACGCTTCGCCATGGACGAGTGCAA
GGCTGTGGTGAGTCCGGTGGACATGAGCACTCGACTGGTTCCAAGCGACGCGGCGACCAAGGTGAACGCTCCGTTTCGCGAAGCTGTTGGTGCGCTGATG
CACCTGATGACCGCCA