Description :
From Genome Similarity Track
Location :
Scaffold_288:11537- 16414
Sequence
4877 bases(100 bases per row)
GATTTGAATTGATTTGATTATGGAGAAGGTGATATTGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTCATCTTGAACACGCGCTCAGCGAGCCTTGTGCTGTTGAAGTGACGCAGGAGTGAGG
CCATCTCGCGTCGAATGCCGATGGAATTCAGGGTGTTGTCCAACTCGAATGCGGAAAGAGGCGAACGACGTGGACACAGGACGTCGATCCCAGCGTTGGC
ACCGCAGACTTCCTTCAACCCCTGAAGATTCTCGTCGGAGAGCTCCTCGAAGCCGATCAGCGTAGACGCGCCGCCGTAGCCTTCCATGGCGAATGCACCC
GCGTGAATGTCGTTCACGATCCCTGGGACTCCCACGAGATATGCGTTGGTCTTGAGATCCGGCGGGGTTGGCAGTGTCCAATGCGGTGGGTGCACAGGGA
GTACGAAGTCGGGGACATCCACCTCCTGCTGCCGAAGCATACCCGCGAAGACGAGCCCCCTGACGTCCTCCAGCGTCGCGTGTCGTGGTAACTTGAACTC
AGGGGCATCCTCCAGGTTCACGTCCGCAGCCGTGTCGCCTGCGTCTGGAGCTTTAGACTCTGAGTTCGCGTCACCAGTTTCCTGGGCTGCAGCGTCAGCC
GAGGCAGTGCCATCGGCCTCGCGCATATTCGCGTCAGAGGTTTTGCCCGCGTCGCCGGAGAAGGAGACGCGCTTAGTTTCCCCCGTCCTGGTGACGCCCG
CCGAAGTGTTGCTGGACGCTGAGTTGCCCGCCTGGTCGCCGCCGCCGCCCGCTGGAGCGGTGTTCGCAGGAGCGTCGCCGGTGCGCTGCTGCGTCGGAGG
TGGCGCGCTGCAGGGGGGCGCCGTGCCTTGAGCTGGCACCGTCGCTTGCTTGCCGTCCGAAGGCACGCTCTCCGCCATGTTGATGATCTGTGAAATGGCG
ATGTGACCGCGCATTGCCCGTTGGAGTTTTTGCGTTTGAGAAGAGAACCTTGAAGATAGGTCCTGACCAACCGTTGGGTAGACAGGGTGTCGCCAAAGTG
AGTGAAATCCTGGGAGTCGACAGAGTGCGACGGCCGTATCGAAGTCGACGGTGGATCGCCCTCTGTGTTTGTGTGGCCTGGCCATGATTCACCGGTTCGG
AGTTATTGCCTCTTTGATGTACCTGGACCAGGAGGGGCGGTTGACACGAGGCGGTCCCCAGAAAATCGCCGACGATGTGCCGCCACCCTTTGGACTTGGA
GTTTGTATTGGATGCTGATTGGTGGATGACTTGGATACGGCGCGGCTGTACCCGTGTGACATGGATGGCGACTGTGGGAGAGAAGTGATTTCTCGGGGTG
AATCCAGCGCCTGACCACAGATGGGCCCAACTGGCTGGAAGTGTGAATCCTGGGAGTGCACGCCCAGGATTTCAGAGAACACTCATTCCAGCCGCGGACT
TTCCCTTACGATGAGTGCCTAAAGTCTGGTGGAAAGTGTCTCTGGCGAATGTATCCCAGAGTACACCTCATCTTGCTGTGGCTCAAGTAGTATATAACAT
CATAAAATGAGGTTAGTTTTTCACGAAATATGACATTAGCGAGATTTCTTGTTGAAGCTCTACATCATTAGAATTTCAAGTGATATAAAGTTGTTCAGAC
CCGGTTTAGATCTCCTACAAGCAACGCTAAAACGTGGTAAAGTTCCAAGGTACCCACCTTCACAAATCAAAATCCAAATATTTGTCAAGGTACCTACCTT
CATGAAACGAAGGCAGTTTTTTCGCCAAGGTACCTACCTTCATAAAACGAAGTCAGTTTTTCTCAAATTTTTACCAAGACATGAAAGATCTAAAACCGAT
AGTTAGGAGTTTCCTTATAGCAGCGACCTTTTATAGATAAATGGTTTCGTAACCAATGCGATCTTAAGATCTCGTGTTCATGCTAGAAGAGTAGGGAGTG
CTCATTCTGCATTCTACCAAGTCAATCAGCAGTCAAGATGAACCCGTCCAACCTACAGCAGGAGATGGATGCTCTCAACACTCGCGGAGCAGAGCTCAAG
AAGATGATCGATGACACGCATCCCGTCGCCCGCATCGCAGAAGAGAAAGCGAAGAAGTTTGCGAGCGACTATAAAGGGGTTCAAGCAGAGGAGGCTGAGA
AGATAGCGGAGGCGAGTGCTAAAACTGAAGAAAAGGTGAGGAAGATGACTGCAAAACTCAAGGCGGCCAAGGAAGAAGCCCAGCTGACGAGTCTAAAGCG
AGAATGGCTCGTCAAGCGGGAGAAGGCGTTCGGTGACATGGATCGTGCGCCCAAGGAGAATGTGGATATATCAAGCAAGCTGATAGAGCTCGAGCGTCAG
TACCTGAACACCCAGCGCCACTACCAAGAGCTACGCGATCAACTCCAGACGGTCAACGGTGTTGCTGACATCAAGCTGGAGTAGCTGTAGCAGGCAATTT
GCAATGAATTAGGTAAAATATTAAATGCGGATTTTACCTTAAAATTTTCAATTATATAAAAGTGAGTCCATCTCAAGCGACGAAATGATAAAATATATAA
CATATAATACGATGACTGTGTTTTGGCATGGATGTAAAAGCTGTTTAAGGACGAATTATGGTTGCGGGCATCATAAGAGAACTATAGCTATGCAACGTAC
TGTGAGAGCATTAAGAGTTCTTAGGATAGCAGATAGGGATGGATCGTTTCATGAACTGATCGAGCTGTTAGTGGACTTCTCAAGGCGACTAGATAATAAT
GCAGATTGGAAGGAATTATTTAATAAGTGCGTTCCATACATGTGGCAATATGAATAATTTATAATTTTTTGGCTCAAAATCGAAAATGCATTTAATTATC
TTCATTTCTGATAATTAATTTCCATTAGTATATAACACAATATCATATAATACAAAATAATTAATTATGGTTTACGT