Description :
From Genome Similarity Track
Location :
Scaffold_107:115358- 117495
Sequence
2137 bases(100 bases per row)
TTGGTGCTGTGTTGGTGTAGGGTCTACAACTCTGCCGATGGTAAAACGCTGATGGTAGGCACTGATGAGACTATTCAGCTTGCCTTCGCGGTGCATCTGC
CGAAGACCCTTAAGCACACCGTTGGATCCCTTTGACGGTACGCCCTGCTCGCCTAGGAGCACTGTGACTTTGTTTGACGCTACTCTCCGAGCTGCCGTAC
TGTATCTTTGTAGCTGGATGGTAACTCGTCGAGCGCGTACCCGTCTTCGATGAAGAGCCTCATGAAGGCCACGAGCTGCTTGGAATCCGATTTCTTGTGC
TTATTAGTACTCTGCCATCCACGCGGAGCAGCCGTGTACCACGCAAACCACGTGTCAACAAGCGGTATTGTCTTGGATCGACGGCGACGCTTTACTGGTA
CGATTTCATCTTCGTCTCTTACTCGCTTGGCTTGATTATCTCGTGCTAAAGTTTCCCCTTCGGTGTTGTTCATTGCAGCTTCTAGCGAGTTAACTCGAGC
TTCAAGGCTACGGTTGACCTCAATTAACCTTTCAATCAAGGCAGTTTGATAATTCAACGCAGCGTTGGCCTTTACATTTTCTTCAGTCATGGCTTCGGCG
GTGGTGTTGGCGTGTTCATTTGACGCTGTGAGCCGTTGTGACCATGCAAGCAGGTTGGTCGTCGTCACTCCAGAGGCTTCCGCACATAGGTGAATTGTCT
TCATTGCAGGTGTCTTCGCGTTGATCTTCACTAACGACGGGTAGTGGAGGAGGAGGGTTGCTGTTAGCACATCTCTCACAACAGCGCAGACGTTAAAGGC
CTTGTTACCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTGAGCTGCTAGCTCTGAGTTGCGGCGGGTGTGC
GGGCCGCCACGACGAACGAATGTGACGTCAGCGACACTTCGACTCAGCAGATCAGCAACGCGATCGAGCACGCGTGACAAGAGCGTGGATTCCAACGGTA
GTGTCGCGTGAACAGTGGTGCTACCTGGCGACGTCTGAGAAGAATTCATGGCACTATTGTCGTCAAGAAGTTCCAGTAATGGTATCGAGGCAGCTAGGTC
AACAGGAACGTCCTTCGACTTCACCGGCAAATGGTTTAGCAACGCTGCACACGGACTCCTGCGTAATCAAGGCCAGCGCGAGCGCTAGCAGCGGACAAGT
CATGAAGTCAGCGTCAGGAAAAAGTGACAGTGACTGCTCATCGGACGTCTTCACGCGGATGAATCGGATAAAGAAAACCCCTCCAGCTCCGACGGAGAGC
TGCTGCTACCGGACGAACGTAATGTCTGATGCACGGCCGAAGAGGTACCACAGGAGGCACAACAACGCAGCATCTTGGTAGTCCGACGCACAGCGAGCCG
TTGAATATAAGTAGCGTATCATCTTCTTGAGATCCTCTTTTGTGCACGCAATAGCCTTCTTGACGAACCCACCACTTTCACGCTTGATGCAGTGCTGTTC
AAGGGTACGCCCCATGCTGAGCAGCTGTCGTGCTACAGCGCCACCTTGAACAGGATACTCATCCAAAAGCCAGCATTTGACCTGGCGGAAGTATTGAGCG
ACGGAGTGGCGCGACAGAGGCTGCCCCTTGCTCCTGCGTGGAATGCCAGGTACACACCAAACTTGTCCATTAGAGTCACTAGTATACTACTCGCGCGACT
AGAGTCTGCGACGACTAAAGCCACGACGTGCTCCATGGTAGTATTCTCTAAAGACAGGAAGCGCTCAAACGCTTTTAAAGCCGTCGCACGCGCGCGCTTT
GTGTTGGCGGGCTTCAAGTCGTTCAGGCTCATTGTTCTTGGTCGGAGAGGTAGAAATATGCAGGTGATACGTGGCAAACCTTTAGCAAGTATTACTATAC
ACATATCTGGTCGTCAACTCCGACTAGATACGTCGGA