Description :
From Genome Similarity Track
Location :
Scaffold_258:11533- 12831
Transcript NameFunction/comments
Phyke_g7356serine protease family S10, putative

Sequence
1298 bases(100 bases per row)
CAAGGAGGACTCATGCGGCCTTGAGAAGCAGAGCTCAGGTTTCATTGACCTCCCAAACCGAGTTGACACTCACTACTTTTACTGGTACTTTGAGTCCCGC
AACAAACCGAGCACTGATCCGTTGGTCCTGTGGATCCCAGGGGGACCAGGCGAAGGTGGCACATATGGACTCTTGGCTGAGAACGGTCCCTGCACTGTCA
ACGACAACCTCTCTACATCGACAAACCCGTACTCGTGGACGACGGTGGCCAATATGGTGTGGGTCGATCTCCCTGCAAACTCGGGCTTTTCCTACTCCAC
AGTCGCTGAGGATGACGAATTCACCGACGAGCGAGTGGCCGAGAGTGTCTTCTGGTTCCTCCAGAGATTCTTCAAAAAGCACCGCGAGCTACAGGGACGA
AAGCTGTTCCTTGTGGGCGAGAGCTATGGCGGACACTTTGTACCAAGTGTAGCGCACTACATTTGGAAGAAGCAGCATAACCACCTCTTTGACAAAGCAG
ACCCGGACTTGATTCCGATCAACCTTCACGGCATTGCGATCGGGAACGGACTGACCGATTCCGTGGAAATCTACTCCCATACAGTCGATATGGCGGTCAA
CAACGCCTACAACATCACACTCGTGAACGAAACCCAGCTGGCAGCGTtaacagctgcagctccaaagTGTCGAGACCTGATGACCAAATGCCAGACAAAC
ACGTCCATTTGTCAAGAGGCAGGTTCGTTCTGGCAGACTAAGCAGTATAGTCCTCTCCTGGAAACTGGTCTGAGTCCATACGACATCCGCAAAGAGTGCG
AGACAGCGGTCTCGGATTCCGTGGCCTGTCAGCTCAAAATGCCCAAGATAAAGGCGTACTTGGACTCGCCCCAGGTGCGTGAATTCCTTGGAGTCGACCC
AAGTTTCGGTGAATGGGTCATGCTCAATTACACGATCAATGCCAACTTCTTTGGAGCACCACACTACTCCGGGTTTATATCCGTGGCTAATAAGGTCTCG
GACCTGCTTGACGCAGGCTTGCGCGTCTTGCTGTACGTTGGAGATGCTGATCTCTTGTGCAACATTTATGCTATTAAGGCAACCgcggagaagctcaagt
ggaGCGGCAGCGAAGGTTTTAATGCTACAAAAGAACGCTTATATTTGACTGCCTCAGGGATTGCAAACGCTGGTACCGTGCGGTCGTACTCGCGCCTGAC
GTACGTGGCGGTGCACAACGCGGGCCATATGGTCCCAGGAGATCAACCTGAGCTCGCACTCGACATGACCTCTAAGTTCATCCGAAATGAGACCTTCT