Description :
From Genome Similarity Track
Location :
Scaffold_20:1153097- 1157845
Sequence
4748 bases(100 bases per row)
CCGTTTTTTGACTGAACGGCAGGTGAGACTTCAGCGGTGTGCGCGAGTACCGGCGCTGGCGCGCGGCATTCCGCCGCGCGATGACCGATCTTCCGGCAGC
GGAAGCAAGTGAGCGGGCGATTAGGACGGCCGTTGGGCCCACGAGGAGTCGACTGGCGATGATTATTCGATGCGTCAATCGCGTCGATCTCCATGGGCTC
GGGGGCTGACTCACGAGCTGCCGTTGACATCGCGCGCGCGTAAGACGCCGCCACAACGTAGTCTTCGCGTAACGCGAGGGCGAATGCTTCCTCGAGAGAG
GAAGGTTCCGCTCGGGTCAGGCAGTACCGTGTCATGCCTTCACGCATGCCGAATACGAATACATGGACCTGCGATGCTGCGTCAATCGGATTTGTCACGA
TGCATGACGCGAGGTGGCGAGTCTTTTGAACGTAGTCGCGCATAGTCATTTTGCCTTGACGAAGGGATAAGAACTCGGCACGCACGCGGGATTCGTCTTG
AGGTGGCTCGAACGCGAGCCTGAGATCTTTCTGGAGAGACTCCAGAGTGGGGAATGCGTCGTGATCAACGACAAGTTTACCGAGGGCCCATTCCTTGGCC
TTCCCGGACAACCGGGACAATAAGAAATTGACCTTTGTCCCTTGCGCTTCGATCATTCTCGAAGCAATCGCGATGTCGACCTCGCGAAACCACCGGTTCA
GCGGGAGGCGATTCGCTCCTTCACCGGAGTAGGTAGACGTCTCTAGCTTCACGACATCATTTTTCGAGGAACGCGCGGGAGTTGTTGCTCGCCGATTCGC
ATCGGCTAGCTCGCGTTCCATGAACTCTTGGGCTGCTTGGCGTTGTTGGTCGGACGTCGCTGAGCTCAGCAGCGACGCGATTACAGCCTCACCAGACACC
GCCGCGAGGCGGTGAAGGGCTTCCCACTCGACACGAGTGAGATGAGGGAAAGCAGCATGTTCCAGGGTCGGCCCTGGAGTTTCAGACGTCATACCTTGGC
TCATCGTGAACTTGGTCATGGGAAGGACTACAAAGTGCTACCAGGTGTAACGGGCCTGGGGTGTCCGTTACTTGCTTACACGTAGTGATGAGGAAGCGTA
CAAGTTCAGTGATACTGAAACCAAGTACTTAGTCTGAAGGAAAATCAACTCTGTTTTTATTTAGGTCCAGGGCAGCTTGCCCTGACCACTCAAATACACG
TCAACTCCTTATTGGTTGATTATGGGTCTGGCTCCCCATATTTCAACCAATAAGGTGACGGCAGTTCAGCACACGCTACTTGTGTGCTGCTACCTACTTT
TGTAATGCAAATCTACCTACTTATGTAATGGTGTGAACCACTACAAAGAACCTATAAAACTACCTACATATGCAACTTGGGAGAGCCCATTACATGCTAG
ACAATTCACGTGAGAGATTTGTTAGCCGTGTTTGAACGGCTACTTCTTTGGTGGATTGCTGAGGCAAAACGGAATCGCTATCGAGTGACGAAGGATGTCA
CTGACATTCCCCATTCAATTCAAGATGATCGATTTGCAGGCGCTGTGCGGATTATTACTATGTATGCCTTGGTGAAAACGGACGAGCTGTGGATACAGGC
TAGGCAGATTGTCGTCCACCGCGTTACGCGTAGTACCTGTTGTGGTGTGCTCAAACAAGTCCATGAACGTCCTTGCCTTCACGATTTGATGCGTCTCATC
GACTCCGAGGAGTCACAACAACCTCTAAAATTGTTCCCCGATCCTTTTGATAGACATTAGTGGATTCAAAACCATTCGCTCCGGGATCTAAATCGGGGTT
TAGAGCCTGCAATCATCCGCAACAAGAGACGCAAAGTGAACAAGCCACACACACACCGCGCTGGTTATGGTGTCAGTGGTACGAGGCGCGACATCTCACA
TTTCGAGATGCTAGGTAACACTTCTTCCTTCCCGACATGCAACGTGATATTACCGCCAATTCACTCACTCGTTACCGGTATTAGCACTCCAGATCCTTTT
TTGCCTTCTCGAGCATGGGGGTTTGCTGGGTTGAATAGTTTTAACGATTAATTTCATTACCATCTCGTTCGTCAACTTTTCATTTAGCTTCCGTTAGCTA
ACTTGCGGGAGCTAACTTAAATCCAAGCTCAATTCACACTAACTCGCGCGAGTTAAATTGAATTAATCTGATTCTGATTCGATTATTATTTTTAAAACTT
GTGGCTGGAGGCGACTACCACTTTAGAATCCCCCATGGCCAAACGCAAGTGTGTGCAGAGGCCAGAGGGGGAAGATGTAGAGCTGCTGAAGGGGTGAAAA
GCCCACCCCCGAATGAGCCCTCGAAGACGCTTCGCGCGAGCTGAACGTGAAAGAACCAACGCTTAAAGGCTGGAAGAAAATGTATTGGGACAAATTAGAT
TAAGTTGTGGGCTCAGACCGAAAGAGAAAGAAGGGCGCTGGACCTCGACGCGTTCTAAAGCCTTATGAAGGTAGAGTTGTCGAATACTTCGACAATTTTA
GCGCCGATGCCAAGTGCTCGTTCTCCGATCTACTGTATTATTGTCAAAATGTGGAAAAAATTGTCAGGGAGCTCCCAAACAATCGAAGCCAGAAGTCGTG
GGTAAGACGCTTTATTGCTGACTACTCTCCTGCACCAGCCATAATATATGTGCCTAACAATGTCATGACCGCCTCTGTGGACGAAAACAATCATCATGAG
GCTGGATATATGATGGCCCTAATAGAATTGCCGGTGTAGCTGAGAATTCGATCAGTGATTATGTGGCGACTATACAAGATGGGGGTCAAAAGGATTGTAG
AGGCCAGGACAAACACTAAAGCTCTGCATCTGAAACGTTTAATATTACATACTCCGTACAAGCTACTGATTTGCCCAAAACTTCACTTGATGCAGCTGAT
TTGGGTGAAGTAGAAGATTCTTTGCTTTATGTGGGTGAAATAGCAGAAAACTTGAGATGAGTGGGCGAATTTGCAGAAGCTTTGCTTCCAGTGGGTGAAA
TTGCAACTCAAGTGGACGATAATAAGGACGTCCCCGCTTCCGCTCCAGAAATGCAGCCGAAGCCAGGTCCACTCTCGCTGGTCTTCTGGAGGCTATCGAA
AAGGGTGTTACATCCAAATATGGTACTCCGCTACGTTTAATGTCAATTACACAAGCGAAAAGTGGAAACATTACAGTTCATCATCGCAAAAACAAGCCTC
CGACACTCACGGTCAAATTTCGTGCTTTGCTCCCGACAAAAGTACTAGATTCCTGCAGCAATCAGATCGCGATATTTCAAAATCGTTGGTCGAGCGACCA
TGGAATACCTGTCCCACAGGATGTCCTCACAGTGATGACCGGAAAGTGTGTATTTAATATACCCACCCCAAAAGCTATACGGTCCTGGCCTATTGCAATT
TCTCATTTTGACGGAATGGATGCAGCCCTAACGTGGGTAAAACTTTTTACAATTCTACTTGGGAACCCTATGAACAGAATGGAGGTGGGTGTTTTGGATG
GTTCAGTAGCCATTGAGTATCTACAAGAATTTTGTGCTCTCCGCTATCACTACTGGGTCACTTTTCGTTGCGGAAAAGCCTTTATTGAGGGTCCATGTAT
CAATCTAGCCGTCAACACAATTATTTAGCTACATCGGAGTCTAGCTACCGTGTTTACAAATCCTGAAGACATTCTGCGCTCCTCAATTTTTGATTCCGAT
TGGATAAAGGCACAAACTACTTGGGAGCAGCTAGCAGCTGCATGGAGCTGAAAAGTGAAAGACTCTTTTTTGGAGTTATCAATTACGAATTGGAGCACTG
ATGAGCTGTAGTGGTCATTTTTAGTGATTACGTTGTCAGCATTTTCGATCCCCAACAGACCGGAGTCAGATACGCAAAGTTGAGACCATTCCTAAAAAGG
GAAATACTTCCTCTATTACCGCAGCCAAAAACTCCCAGCCGATTCCGCTTTAAAAGCGTCCACTACTGCACTTCACAGCTGGACAGTTATAATTTGGGGA
TCTTCGCGTTGTTGTTTTTGGAGATGGGATTTACGGGGAAGAGCCGAAAGGCTTGAAAGATAACAGTAGATCTGCGATGAATTTCTTTCGTTACAGATAT
CTTAGCCACATATTAACTTCATTGCAGCAGCGGTAATGGTCTTTCTCAATAGTAATACTACAGTAAATTATTGTAAAATAGCTACACCGGCATCCATGTA
TCGTCTTAGAGTAAACATACTATTAAACTACCAGCGTTTCACTACGTCGAGCGAGTTACAGTCTCAATGCACTTTAAATCGCGCGAGTTATAGTGAATCG
GTTGAAGCATATATTAATGTGGTAGTCACTTTTATTAGCAGTGAGCTCACGGATGTGGGCGTAGGATTCGCATCTCCGTAGTAAATTTTAAAAGGATTCT
AGCCAAATATCACAAGCAAAATTACCACACAGTGCTCCCAACTCGCGTAATAAAGAGGTATCGTTCGCTTACGAGAGAGCTCTTGTTCATTCTCGTGCGA
GCTGTTCTGCAAACTCACTAATACATGTATGGCTTATTTCTTGCACAGACGTACAGTACACTTTGAATTTGTCTTTTGCGGGGGCGCTCCGCAACGGGTG
CTCCTTAGATTCTCCCAGGACACACGTACCAATCTGACTGACACACAAAATCATGCCCGATTTGCAACACTAGCAGCAAAAGGGCAGACCAGGATCGTCT
TTTTGTTCGCCTCTCTAGCCGAAAGGCCGATAGGAATTAAATGTAGGT