Description :
From Genome Similarity Track
Location :
Scaffold_2:1153045- 1154831
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G000769Similar to TAT: Tyrosine aminotransferase (Bos taurus)

Sequence
1786 bases(100 bases per row)
TGGTGACGCTTGCAAAAGCTGGCAATGCGAGTGTATGCGTCATTCAACACGTCGTGTGGAGCTGAAAACACAATGCGGAAATAGTTGGTCATGCCAAAGC
ACTACCAAAGATACACATAACGCAGGATCATGTCAGCCAAGTCAATTCCCAATGCCAGCAGGAACAAACAAAAGAAATCGTACCTGGCCAGGCAAGACAA
ACACCGATTCTTCGTCAAGGAGCTTCTGGGTAAAGTCAAAGTCGTCCTTGATGCCCGTCAAGATGCTCGTGTCCACACCAACCATCACGTACATGGCGCC
CTGTGGCACCACAACCTTGAGACCAGGGATCTTGCTCAAGGCATCCGTCGTGAACTTGGAGTTCTTTTCCAGCGTGCCAAAGTAGTGCGTCTTGAACGCA
GCAAGGGACTCGGCTTCTGCGCTACCAGGGGCTGGAGTCAGCAAATCTGGAATAGCACTCTGTTGCATGAAAGAACATGAGAAAAAGTGTCAGCTATAAA
GAACAATAGCTGACTCCACCGCCACCGCCAGTGCTTCTTCTTACCAGGACCAACGAGTTGGCGCCGAGAATCAACTGCGACAGCTTGAAGTACGCCGCTC
GCACATCCTTCAACACATCATTGCGATCGTTAACCATAACCCAACCCACTCGCCAGCCTGGGATCAGGTAGTGCTTGGCGAGGCCACCGCACGCGATGAC
TGGAACGGTCTTGGTCAACGCAGCGAGTGGGTAGAACATGTTTGCACCGAAAACCATGTCGCCGTAGATTTCATCCTGTATAGTAGTTGACCGAACACGT
GAGCACGGTACTCTTGAGCATGCCAATATGAAATGAGATGTGTTGGTGCTTACCGAGATGATTGGAAGCTTGTTGTACTCGGCAAGAGCGAGAATCTTTT
CCAAGTGTGCCTTGGAGTACACACTTCCACAAGGGTTCGACGGATTGTTGACCAAAATGGCCTTGGTGTTTTCATCAACCAGGGATTGCATCATTTCCAA
GTCTGCTTCCCAGTTGTTCTCAGGCTGTCAAAATAGCAAATCCTACGTCAGTTTGCCTGATCAGCATGACACTGGGGAAACACATGAATGAAGTACGTAC
AAGAAGGTCGTAGAATTTGCACTCGATCTTGTGAGTTTCACAGATCACTTGGTACAGTGGGAACCCTGGCTTTGGCAGCAAGATATTGTCGCCCGGGTTC
AGCAGACCAGTCAGTGCAATGTCGAGCGCACCCGAGCCTCCACTCGCGATGATCACATCCTGGATTCAAAACCAGTCACACAAGCCATACAATTAGACCA
AATTGACCTAAAAATGTGTTGGAGGTAACGTACATCCTTGGTCAGTGGTGCGCTCGGACTCCCATACTTCTTGGCAATGGCGTCACGCGCTTCTTCCGTT
CCCGCCGAGTGGATGTAGCCATTGTGCTTCATGGAACTATATAGACACCAAACATATTGATCCTTCCGCATTAGCGTCTCTGCCACATAATGGGTACGAT
TATAGAGCTCAGGCAGCAAAACACGCACCGAACATTGCGGACAATCGTCTCCACCAACACGTCGGGGCACTTAAAGTTGCCAAACACCGTCGGGTCGCCT
TCATATACAAAAATAAAAGCAAAAATATGTATACCAGGTCAACCACGTATCCCCTCTACACACAGCCAATTCGCATCGCTTCTTACCGAGCGAGAGCGGA
ATGAGAGTCTTGTCGGTGTTCTCGGGTTTCTTGATGTTGTCGACGATCTTGCGGATCGGGTTGGCGCACAGCTGCGAGAGTTCGGA