Description :
From Genome Similarity Track
Location :
contig_77:115270- 118286
Transcript NameFunction/comments
g10126.t1hypothetical protein
g10127.t1hypothetical protein

Sequence
3016 bases(100 bases per row)
GTTTGCTTGCCGAGTGCACACCCGTCGCACAGCTCCCACTGCTTCACCGACGTCATGTCGATGCCAACACCGTAGCTCTTCTTGACGATGGCGTCTAGAC
CGCCATGGCCAATGTGACCAAGTCGGAGGTGCCAGAGGTACGACGTGGTGTCCCCTTGGCGATCCTTCGAACTTGCCGCATTGGCCTCGTCAGGCATCAT
CGGAGTCATGCACAGCTTGAACAGCCCTTTGCCCTCACGAGCGCCGAGCTGCCACTTGAGACCCTTGTTGTCCGCGAAGCACCCGTCGCTCTCGAAGGTC
ACTGGCCCGACGTCCTTGGTGAAGCGGCCGACCGAAAACAGGTTGCGCGACAGCTTCGGGATATGCCACACATTCGTGAGCACACCCTTCTTCATGCCGC
GCGGCGTCTTCATCGACATGACAATGTCGCCGGTCCCCACCGCCTGAACCACACCGTCGTCCGCGAGATGCACGTCCACCGGAGCCATCGTCTTGTAGTT
CCTCATGTACTTGGAACTCGTCATGTGCTGCGTCGCACCCGAGTCGACCAGCCACATGTCACTCGGCTTGGCGGTACTGCTCGTACGACCAACCGAGAAA
AGGTAGTCGCCAGGATCTTCTTCGTCCTGCGCGACGTTCGCACGCTGCGACCGATATCGCTCAGCGTCGTTTGGACCCGCGAGGACACTCCGCGATCCAA
TGTCCTTGTTTGCCGCAGTTGTGGCACGCCGGTCTTCTTCACCGGTCGGCCCTTGCGCTTGTTGTCTCTCGTCATGAACGCTTGACCTTGGCCGTGCGCG
GCTCCGTCGACGCCGCCACAAAAGGCTTTGGTCGGTTGATGGCAAAATGCAAAGTGATTGATTTAGGTCCTTAGTTCGCAAACTCCCTTGCTACCTCTAA
GCCTACTGGATTCTCTACTGGATACACTCTACTGGATTCCTTACCGGATACTGAGTTGCTTCAGCCAGTCAGCGACTGCCACGTGGATGCCCATCTTGTA
CCCACAATCTTGTACCCACGTGTCCCGTAATCTCCGTAGCGTAAACAGCGTCCCATCATCAGTGTCCCGCGTCCCATCATCAGCGTCCCGTCAACACAGG
AATGATTGCGGTCCCACTAAGTGAAGGTCATACCGGTATCCTACCGGTATACGGCAGCTGCCCGAGGCGCCTTCTTGACAACAAGCAGCAACGACGAGCT
GTTGGAATTGACCAAGCACGCGTTGAGCAAGCGGTTTGAGATGACGGACCTCGGCGAGCTGGAGTATTTCCTCGGGATGGAGATCAAGAACGACCACGGC
TCCGGAAAAGTGACGGTGCGGCAGACCAAGTTTCTCAAGTCCATCCTGACCAAGTTCGGCATGCAAGACAGCAAGCCTGTGAAGACGCCGCAAGACCCCG
GACTCAAGCTGACCAAGAACATGTGTGAGGGTGGCTGCCAGCATGAAGACATGATGAAGAACGTGCCGTATCGGAGTGCCGTCGGTGCTCTCGTGTACTT
GATGGTGGCAACGCGTCCGGACCTCGCTGCTGCAGTGGGAGTGCTGAGCCAGTTCTCTGCCGACCCGTGTCCGACGCATTGGCAAGCCCTCAAGCGTGTG
CTGCGGTACCTCCAAGCGACGCCTACGCATGGACTCGAGTTCTCACGGGAAGACAGCCTTGGTATGTGCGGATATTCGGATGCGGACTGGGCCGGCGACA
TCGAGTCAAGACGGAGCACAAGCGGCTACGCGTTCATGATGAACGGCGGATGCATCAGCTGGAGGAGCAAGAAGCAGCGGACGGTGCGCTGTCTTCAACG
GAGGCAGAGTACATGGGCTATCGGAGGCAACACAAGAGGCAGTGTGGCTCAAGGTGTTCCTGTGCGAGCTCGGCGAGATGGCAAGCGATGAAGCGGTCAA
GATCTACGAGGACAACCAAGGCCCCATCGCGTTGGCCAAGAACCCGCAGTTCCACAAGCGCACCAAGCACATCGACATTCGCTACCACTTCGTGCGCGAG
AAGGTGGAAGACGGTCAAGTGGTGCTGCAGTATGTTTCGACAACCGACATGCTGGCGGACATGATGACGAAGGCGATCACTGCGGTGCAGTTCAGTGTGC
TTCGGAGCAAGCTCGGGATCCAAGTGCAATCGCTGTCGAGTCGAGTGGGAGTGTTGTCAAGAAGGCGCCTCGGGCAGCTGCGGGATACCGGTAGGATACC
AGTATGACCTTCACTCAGTGGGACCGCAATCATTCCTGTGTTGACGGGACACTGATGATGGGACGCGGGACACTGATGATGGGACGCGGGACACTGATGA
TGGGACGCTGTTTACGCTACGGGGATTACGGGACACGTGGGTACAAGATTGTGGGTACAAGATGGGATCCACGTGGCAGTCGCTGATTGGCTGAAGCAAC
TCAGTATCCGGTAAGGAATCCAGTAGAGTGTATCCAGTAGAGAATCCAGTAGGCTTAGAGGTAGCAACGGAGTTTGCGAACTAAGGACCTAAATCAATCA
CTTTGCATTTTGCCATCAAGCGACCAAGCCTTTTTTGACTGCCTGGAATTGGTGAAGGCCATCTACGGTCTCAAGCAAGCTTCGCGCGTGTGGAACGAGA
CCTATGACGAGTTCATGTGCTCTATCAGTTTCCAAGTGTCGGCCTTCGATCCGTGCCTCTACATCAAGGTGGTGGACGGTCAGTGCGTGCTCGTGCTGGT
GTACGTGGACGACGTGCTGATTACCGGGAGTTCACACGAGCTGATCGCACGGACGAAGACGGACCTGAAGACGCGCTTCGAGATGACCGACAGCGGCAAG
TGCGCGTTTGTTCTTGGGATCGAGCTGGTGGACGGCCCGGACGGCAGCGTGACCATGTGCCAGCGTCGCTACGTGGACGACATCCTGAAACGCTTCGCCA
TGGACGAGTGCAAGGCTGTGGTGAGTCCGGTGGACATGAGCACTCGACTGGTTCCAAGCGACGCGGCGACCAAGGTGAACGCTCCGTTTCGCGAAGCTGT
TGGTGCGCTGATGCAC