Description :
From Genome Similarity Track
Location :
Scaffold_173:115268- 117527
Transcript NameFunction/comments
Hyaar_Emoy2811872myb-like DNA-binding protein, putative

Sequence
2259 bases(100 bases per row)
GCTCTGGATCGGAGAGTCTGACGAATACGCAGTTGATAGACGTAAACGTATCGTTGCTCTTTTGTTGGACTCATACAGGCATCAAACCAGTCTTTTCAAT
TGCCGCGCAATGTCGGTCACTGCACATGTATCCCAAGCACGCTTGAATAAGCGGAGTTGCTTTTGCATCTCACTGAGCTTGTTGATAGAGACAATAATTT
TCATTACACTGTTAGAAGTTGTGGATAGAGCGGGATGTCAACAGCGACATGATCGTATCGCCAAAAACCGGCCACTCGTTCTCGTCTGGTCAGCTGGCTG
GGTTGAAATCGTCAGCAGCCAGCTGGTAGGCCAGCGCCACACGCGTAATCTAGCTTTTGTACACCACGTAATCGGCTTCGTGGAACCGGAGTTTTATTGG
ACGGTCTTGACCGACGCGAATATGACGCGCTTCATAACAAGGCCAGCACTGACGCACGTCAAAAAGTGGTGATTACTTTTAACCAGTGCGATGCCAATCG
ACGCAGCATGCACATCAGCAGCCGCATGTGACATGCTGAATTCGAACTGGCACTCGAGTTGGAATCAAGCTAGAATTCCAACAAGATTAATCTGCTGGTC
CTGGACGCACTAAGTCAGGAAAACTCGGGCGAGGATGGACCATATGTGTTCGTAGCCAACCAATCTAGAGCGCGATTTCCAATCTGGAGAATCGAATATT
CTCGAGTGCATCCTGTGAGTAAGGTGACGCTACCACAGCAATCAAGCTGATATTTTAGCGGCGGCGGTTATATTGACTTCGCTTTGGGAGTTCCCAACAC
TGTACAACATTACCTTACAAATATAACCCGTCATGGTTTGGCTGGATGGGACCTAGATAAAGGGTAAGTAGGTGAGCTCGACCTATAAAAAAAGCGGCAC
ACCTGCTGAACAAAATATCGACGAATACAAGCTCGATACCACTGCGAGTAGGTAGGAGAAGTGGGCAGTAATCACGTCAATGGTCGATGCTGATATCATA
GATAACCATCGTTCGTAGCTATAACTGTCGCTTTCGTCAGCCGTGGTACCGCTTTTCTTCGCCATGGTAGAGATTATACATACGATGACGAGCTCGCGAT
AATCATGGTAATCTTTTTATCAGCACCTCTTTGAAACCCACTTACTCGAGCTGCTCAGTCTGTCTACGAGACCACAGTCGTTACATAACATCTTCGTCAC
CATAGCTCATGGATCATCTCTTCCAAGACAACAAACTTTCCATTTGAATCGCATCTTCACACGTGCTTGCTTACTTGCTACATCCAGCGCCGAGTGACAG
CAGCGAATCAGCTCGACTCGTCGCAAAGTGTGGGTATAAACCGCGCCGTCATTTATCTACATCGTCAGCGCCTGGCAGTAAACTGAGTAGCAACTGTCCT
CCGCGCCTGGCTCTTGTCAGCTTGATGGTGGTATGAAGCGAGTGGGCGGACGGCTCTGGCAGTCTCGACATGAAGTCAAAGGAGCACAGCCGGGTCCCTA
AGGGTCGACCAACCGTCAAACAAACGTGCATTTTTCAACTCGCGACACATTGAGCGAGCGAAAAACTTGTGAAGCCACTTCAGCTGATAGCCGGTTGGTT
GTCTGTCGCTATTTCCACCACCATCAAGTACCATTCCACTCTTGTCTGCAGTCAGTCCATTGTTGTACCGATGACTTGTTTCGGATCGAGCTCACCGTTA
TCGGTCACTATGCGGGAAGCGACGTCCATGTCGCCGACAGCAAAAGGAATTTGGTCCCAAGACGAGCACGACCGCTTTCTAGAAGCCATCAAGCTCTATC
CCAAGGGACCATGGAGGACTATTGCAGATCACGTAGGTACCCGGTCCGTGCGACAGGTGCAAACCCACGCACAAAAGTACCAGGAGAAAGTGTCCCGTCG
ACTGCGGGGGCTCCGCAAGACCAAGAAAAAACTCGTGCGTCCGGAACACCGTATTGATGAAGACACAATGGAACTCTGCAAGCTGGTGGACTGTGCTGCG
GACAAACTGGTGGCAACTTGTAGCAACTTATCGTCCAGAGCTACGGGCACCGAGCTAGAACTGTTGCCGAAGGAGGATCGGTTACAGCAAGACCTTGCTG
AGACTACTGGCAGTCCGCGGGGCCCTGATATTCCAATCAGGACCAACGACTTTTTGCCATTGCCGTGTGTCAAAGTCGTCGACGAGATCGAGTTGGATCC
AGTCCACATCCCCACCGTGAGCGAGTCACTTGACTTTCTGATCGAGTATCTGTCGATAT