Description :
From Genome Similarity Track
Location :
Scaffold_32:115239- 123627
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_07627cellulose binding elicitor lectin (CBEL), putative
Sappa_CBS223.65SPRG_07628Hypothetical protein

Sequence
8388 bases(100 bases per row)
GATGACAGCGAGGCGTCGCTATCTCGGACCAGTCTACGTCGGGGCGCTCTATCGAAGCGCTACGTACTCGACGCGAGGGCATTGGCTAGACGATCGCAGT
CCGCGCAACAGTACAAGCGAGTGAGGTTGAGCGAGCAACCTATACCTTTTTGCGATACTTGACGATAAAAAATGCGTCATTGTCGTCTACATATATAAAG
CAAAGTACGCGACATTTCAGGCGGTGTAATAATGTCTACAAGCGATACGTTGTGTAGCTGCCCGAGACGACGCCGGGTGTGTTGCTTTTGTTGGCGAGTT
TGTTTTTGAGCCAGCACGTGCCACTGTTGATCGCGAACCCGACGCACCCGCTCGTCGATGCGCAGCCGTTACAGCACTGCGTGCGCTGCGACATCGCGTC
GCCGAGGACTGGAAAGCTGCGAATGTCGTTGCCATAATAGTCGGTGTTGCTCGCAATACTGCCGCACTGGGCTGCGCTGCCCGCAGATGCCGAGATGCAG
TTACGACAGGGCGCCGCATTGAGGAGCTGGCTCTTGAGCCAGCACGTGTCGCCGTTGATGGTGAAGCCCTTGCAGCCGCGCGTTTGCGTACAGGCGCTGC
AGCACACAGACACCTTGTCTTGGTTGGTGCCCGAGACGTGGACGTTGGCGATGTCGTTGCCATAGTAATCGATTTCGTTTTGCACATTGGCGCACTGGCC
GCCATTCAGAGGCGGGGCTTGCGTCGGGTATGCGCCGCTAAACGCTGCTGAGAGGCAGTGGAGGCAAGGCACAGCAACGTCGAGTTTGCTCTTGAGCCAG
CAAGTCTCCCCGTTGACGGTGAAGCCCTTGCAGCCGCTGGTCGCTCTGCACGCGCTGCAACAAGCTGTCACTTTGTCGTGGCTGCTCCCCGAGACGCGCC
GATTCCCAATGTCGTTGCCGTAGTAGTCGACCTCTTTTTGAACCGTCGCACACTGACCGCTGGGCAAGAGCGGTGCTTGGGTCGGCGTGGAGGTAACGAA
CGCCGCCGAAATGCAGTGGAGACAGGGCACTGCATTGACAAGCTGGCTCTTGAGCCAGCACGTGTCGCCGTTGATGGTAAAACCCTTGCAGCCGGTCTTT
TGCGTACAGGCGCTGCAGCACGCAGACACCTTGTCTTGGTTGGTGCCCGAGACGTAGACGTTGGCGACGTCGTTGCCAAAGTAGTCGACACCGGTCGCCA
CGTCGGAGCACTGACCGCCGTTCAACGACGGTGCCGACGACGGTGTCGTCGTTGGTGCGGGTGCAACGGCGGGCGCCGACCCCTGATCATTGCCTTGCAG
TGGCACGCAGTTTTCTACACACCGTACGTTTATCTACCGCGATTCATGAAACGGGGGGCGTACTGTAGACTTGCCACTGGGGCTGGTGCAGCGCGAGCCA
ATAGAAGCGCAACAAGCACCCGTTCGGACCACATTTTGTGTAATCCACGGGCAGACGCGCTTCGGGGGCGGCTGGGAAGTTGGTCGCGCAGTCGTTGTTT
TGAAACACGCGCGTGCTGTCGAGCCAGATCTCGCACGGACCCGTGTGGCTCGGGATGAACCCCTCGCCCGTGTCGGGGTTCTTCCACGTCATCTTGCCAT
CAGACGGAATGGCCTTGGCAGCAACATTTGGCAGCGTGTTGCCGCAGTCTGGGCCGTGCAAATCGAGCAAATCCCGGAGTGTCTTGTACTGCGTCTGGGC
CGCAAACGCCTTGTTGAAGTTGGCGACATTAGTCTGCGGCGAGTCGTCAAACTTGCCGGGTAAGAACGCTTGGATGATGGCCACGTAGGTTGTCCGCATG
ATATTGGGCGCAAACTCGGCCAGGGGACTGGAAATGACGCCGTGACCAGAGATGAAAGGCACGGCGAGCGCGAGCAGAGTCGCTGTCCGCTGCATTTGCG
TAAAAGGAGCAAAAACAAAAATGATGTGCGGAGTGGGTTCGCATGTGCTTGCTCCTGGACAGCATCGCCGTCGTTTCGACGCGTCCGATCTCGGTAGATT
CCCGCGTCGTCAACGCACATTAAAATGGCGTTGATTCTGAAAACGACACCTGCTTATCGAAGAGGAACATCGCGCGAACGGTCCAAAGGAACGCGCACGG
CACAACGACGCTGCCGGTGGCGAGGTGCGTCTCTTCGCCTGCTAGTGTGCGCGAATGACAAGCGTCCAAGCGCGTTCTGCGCGGGTTCGAGTCGAACAAC
AGAACATCATGATGATCATTGCGCCAGAAGCGTTCCATGCGTCGTAGTCACTAGTCCATAGTACGTACAAAGGGGCGGGCGACAGTTCATTCATTTACAC
GCTGTGCCAGGCTCGACAACTGGGATCCAACACCCTTGCTGCGCGACTCTTGCATCAACTACATGTTGCCTTGGGTATCGTTGCGGCAACCAACAGGTCC
TTGGCGCGCGAGGTGCCATCGATTGGTTAACGGTCTCTCAAAGCGCTACTGCAACAGCACAGCGACTAAAACGTTGCCTAGAATGCAGCGGTAGCACCCA
TCGAACGTGGTGGAGCCACATGTGGTAGTTTCATTGCGTAGCGGGAGGACCAGATTTTCTACCAATCGGGGCCGGGAGCGAGCGACACGCAGAGCCCAAC
GTCCCCAATTTAGTATTCCGCAACTCGGCAACAAGTGTTTTCTAACCCACCCGCCTTCCCAGACGGGCGGCGGGGAATGTCAACATCACATTTCCCCCGC
ACGCCACTCGCGACGACGGTGTGGTACGAGTCGTACAGCAGCCAGGAAGAGACAGTAGGCTAGATACTCACTTGTCCCTTGCCCGCAATGCCACTTCAAA
TTGGCTACCGGTCAATCGAATCATCGTCTAGTACCCCACTCGAGCGTCGTACAAGGTGAAACTACACTGTACCGAACAGTTGATAGGTAGTTGGATCCAA
AGCTACAAAGCTACTATACGGTTATGACAACATGTATGGATAACGTCGTCTTTACTAAACACGACCAACGCTACAGAACGTGTACTCGTCATCGCCGCTG
TCGTCGATTATCATGGGCAGCTGGTGCGCATACGACAAGATCTCATTGCGATCCTCCGCGACGAGGGTCACTCGTAGCGTGCAAGTAGCCAGCGGCACCA
GAGCGTCCAAGAGACGGCACGCTCCTCGTAGATGCAGTTGATTGTTTTGCACGAGGTCCAGCGCCAACGGCCAGGTACGAGAGCCGAGTGCGCTGGCAAC
GTCAGCCACCGCATCCTCGTCGAGGTTGCAGCATGCCAATCGCACGTACGTAATGTTGGCACGACTGAACCAATGGCGCAGTGCACGCTGCATCGACGCG
CGCGGGCCTTCACCCAAATAGACGTTGCGGAACGAGATATGCTCCAGGCGCACAAGGCCACACGTCCAGTCCAGAAGCAAATTGACCTCCTCCGCCGACA
TCAAAAACGTGTCGAAGGATACATGGCGGAGGCAATCGTGTGCGATGGGAGCGGGCAAGTGATCCAGCATTCCAGGACCCAAGCAGAGCGTCTCGAGGGC
TGGCAGCGTTGGAAGCCACTCGACGACGAAGCTGAGATCATCCATGGCAGTGACGTCGAGGCGCGTCAAGCGGCGTCGATCGACAAGCGACAGCAACTTT
GCGACCGACGACTGGTACACACCATCCAAGCGCAGCTCGGTCACGTGCGATAACGTCTTCTTGGTGGCTACGAGCGCGTCGACGAGCGCGTCGATATCAG
ATCCATCGAGCTCCATGCTGTGGAGCTCGAGGCTTTGCAGCGACGGCGCGGTTGTTAGTGCGTCGGCTACGCGAGCATCATCAAAATGCCCAACGCAGGC
CAGACACAGATGGGTAAGCGTTGCAATCTGGGGCCACGCGAGCAGTGAAGTCATGTCGATTGCATCCGTGTCGTCCCCATACATGCCCTTCGTATTGTCC
CACGGGTCCCGTGCAAGCGAGAGCCGCCGCACGCTTGGCGGTAGCCATCGGCGGAGTCTGGTAAACATGCCGATCGAGACACCAATGTGCGCCAGGCGTG
TGCAGCGTGGCAGTGCCGCTGCGATCGCGTCGACGTCCCAGTCGTCGTCGTTGGAGGCGTGAATCGACGTGATCGGCCATGCTGTGAGGAAGGCGATGAG
CTCGCGACGGCCCGAGATCGGGAGGTCGCGGAAGCGCCGGATAGCAATCGATGGCAGCGCCGGCAGCGCCAATAGGGCCAATGGACGGTACGACAGCGCG
ACGTCCTCGAGGCAGATGACCGGCCATTGCTCCAGAAAGGCCGCAGGCGACTGCAGCAGCGTGAGGAGCGCCTCCAGCGGTGCACTTCGCATGTGTGCTG
GCAGCGCCACAAGCAAGGCGCGGGCGTCGTACGGTGATGCCACGTAGGGTACGATTGCAGTCGCCGCCAGGACCACGACGTCGGCTGCTGGCATCACGGT
TGTCACTTCGTGATCGTAAGCGGATATATCCGGATAATTCAGAGCCTGCCTGTGGATTGTTGGCTTTTCGAGCATATATGACGCAGAGATTGACTTGTAT
GCGGCCTCTTAACGTTGTTTGGATAGCGTGGATACTACACATTGGATTATACAAATTCCAGGATCAACATCGCGACGCGAATGAGCGAAGACGTGTACCA
ACACGTCAAGCGTCAAGCAGAGGCGCACCACGGCGTGTCCATGATGTATCGACCGTGCAAGGATTACAGTCTACATAGCCCAAGTCGCTAAGCCAACTGG
TGGATTGCCATCACTTCCATATTGTCTTAGCACAGTGCACATCTATGTTAGCACGGGACGACGTACTATCGGCCACCGAATACGCGCCGGTGGGCTGGAT
GATTCGTCCCGCCACTGGTGGGTTTGGTCCTATAGCAACGCTTTTATTGGACAGAATATCGACCAATGAAACGCATGTATTTGTGATCTTGGCAACCGCT
CAAGATTTTGTAGTTTGGAAAAAGCGTTTCGTCATGGCTGCCAAGCCGACTGTAGCTCGTCCTCGGTACCTCCTGGTAGTCGACGCCGTCGCAATCTCGA
TCGTCCAGTGCTTGGCCACCGCCGACGATGCGCTGGCCTTTCTCACTTCCATGCCGGCGTCAACGTTGAGCGCGCCACTTGCTGCTCTCTTGGTGCTTCT
TCGCGCTCCCAACGTCCTTACCACGTGGCCTGTAATCTGCCTCGAACATATCGACTCGGTATACCAGTCCCTCGCGCTCGCAGCGCTTCCGGCACTCCCC
GGCATTCGCATTTGCTGGTACCGCGGGCTTCAAGACGTACTCGGTAACCGCTACAGCAGCCTCGGTGCATTCCTCACTACGTGGCCAAACAAGCTCCAAT
CCATCGAGAATGCCATTTTCAGCGCGTACTTTGACGAGATCAAGCACGCACTGCCACTGTGTCGGCGGCTCACCGACGTTGACGTCCGGGTCAAGCACTG
CATGACGCTCCTCCCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTTCGGTTCGCACACTGCACCTCACTGGAACCTACTCGCGCGCGCGGCGACGGTCCATTCCGGCCACTCCATTGCTGCACTGGT
TGCAATCCTCCAATGTCACGTCGTTGGACCTTGTTGGAATCTTTTCTCATGGGGACGCCGTTGCGTTGGCGGCCGTGCTTGCGCAGGCCTCGTCGCTTCG
AAGCGTGAGCCTCGTCGACTCGGACGCGCTGCTCCGTGCGATTTTCGTAGCGCAAACGTCACTGCATCATCTCACGTCATTTGTTGTCAGCACCCGCGAT
TCAGCCAGTGTCGAGCACCTCATGCTGCACGTATTGGATCTCTCGGCGCTCACACGGCTCGACGTACACTGCAACAGTAATTTGAGCTGGCTACTGAAGC
TGCTGCCCGCAATGCGATCGCTGAACGAGCTCGCGTTGCGCGGTGGCTATTTTCACAGCGTGCCAGCACCGAGGATGCACGATCGGCTGCGTCTATTGAC
TCTTGAGGACGTGCAGACGGCAACGAAGGCTGATGCCACAGCACTGCGTCATTGGATGAATGGCTTGCACACGCATTGCGCCATCAACCTTCGTACAACG
ACCATTGCAAACGATTCAAAGCGCTCGCATCCAGCACTCTCGCCCGATGCCATGTAATCTAAAAGTATAGATAATTTGTACGCCAAGGGTCTCCAACCCC
GTTTCATTTCATGGTTTGTAGATAGATACGACGATTTTTCGCGTGAATAAACACAGCAATACTGGCTGTAAGCTCCATGCAGGAAGATTGCCGCTTACAT
GCACGGAAAAATTCGACAGCGTCGTGCGTGGGGACGCCGGAAGAAGCGTCAACGATCGCATCGGTCAGCACGGTCCAAAGCTCCTTCTGCGCCATGACGG
TGAGGTCCGTGAGGTCGTCTGGGGCCGTGAGGCGCTCCTTGAAAGACGGAACGCTGAGGTTGCCGCGTTATAGTCGGTATGAGAGCCCGGGCTTAAGCTC
GTGGACCTGCTCTCAACGATACCTGCTTTGGAACCTATGCACCTTGGTCCATATCGTGTCCTCCAGCAATCGTACCAGCAAATCGCGCCAACACCGTTCG
TGTAACATTGTGGTAGATCATTTCGCCATGCAACGAAGGCGAGCAGCTCTGGTGAAGGTGCGCAGTCCGTTGGCGAGGGCTAGGGTTATGAAGCAAACCT
TGCAAAACTACGTTTTCCGCGCAACCTTGATGCGGTTGGACTCACGCGCGCGGTGTTGATATGGATGGTAAGAGAGTGAAGCTGCTGGATCACACGTCAT
CTGCGTTGAGAAGCGGCGTTACGATACAGTAGATACCGACGCTTTCCACTGCTCGCAACTTGTCGCTCCAAAATCTCGGCATCCACCTCGCCACGGTCTG
GGCTCTTCTCGGATCGCTATCCCGCGTCGTCAGCACCATGGTCCGCATCGCGGTAAGCATCAGCGCCGACACGTACAAAGAGGTCGCTCGTCTAGCCTGG
AGGGACTCTGGCGTCGCGATGCTGCCTCGATACATCAACGAGTACGATCTCCTAAGCCCCTAAGCAAGCTTTGAACCATTATGAATGACATTTTTTCATC
GCTTGCAGGCTGGGAAGGCCAGAGACACATAGAACACGATGGTCCTCATCTTCGCAGCTGAGAGACACCTCGAGTCTTATTGTCTGTCAAGGTCCAGCCA
TGGAGGAGCTCGTGCTGGACGTATTAATACGCAATGCCAATGGTCGACTTGTGTAAGCTGCACCAATGTAAACAAATATCTTTGACTGCTTCGGGTGACG
CGACCAGCAGCAACGCTATAGCTCAGCCTGAACCAATGGGATGTTAATGATGTCCTTGCGCGCGCCAGGTAGACGCATCGCGCCAGGTCGTCCTCGCGGT
CCCGGCAAGACTCCCATTTTCTGATTGTGTTAAGCATTTGCATTCGCTCCGTCACCTGCCCTATGTTTCTTTGTGTGCGTTTGTCGGAAGAGTGCTTGCT
TCTCGATAAGCCTCGCAATCGAGGGGGAATACCCTGGCACGTGCTTGTCAGTGGGTGTTGTCATCCGGATACCGAGCGTAGCGGATCGTGGCCACCCGCC
AATCAAAATACGGTGGCGCGATCTATTTTTTGGTTCTTGAACCGACATGCGTGAATGGTCATTTTTGAAGCAAGTGCAACATGGCCACGAAGCGGATCCA
TACCGTGCCGACACCAGCCTTAGCTCTCAACCACCTCCGCGTCGCAGTCGTCCAGTGTTTGGACTCGTACCACGACGTCGTCGCCTTTCTTCGAGCCTTG
CCGTCGCTTTCGGCGCCACTGGCCGCGCTGCTCGCACTGCTACAGGGGTCGTCGCGCGCCATGGACCAGTGGCCCGCGATCGCCCTTGAACGCTTGAGCG
AGAGCGAGGTGGAGCTGGCGCTCATCGCGCTTCCCGCGATACCTGCCATCCACGTCCACAACCGCGACGATTTCGACGACAATCTCTGGGCGCGGGTTGC
CGGCCTATGCACGCTCGCAGCGACGTGGCCGACCAAGATCACGCACCTGAGCGAATGCATTCAAGACAACGAGATCCCGTACGTTCAGCGCATCGTCTCG
CACTGCACTCGCCTCGATGCCATCGTCCTGCACCTTGACGCATTTGCGCCGCTCCTGCCGTCGCTGCCACGTGGTCTTCGCCACGTAGCGTTGATGGCCA
AATTGTATGTGCCCCCTCCGATACAGAACATCGCACCGACCTTGCGGCAGTGGGTCGAGGTTGGCACGAGCAGTAAAAAGCACATTAGCTTCCACAACAC
GTGGGTGCTGAGTGACGCCGAGGCTGTCGCAAACGTACTCGCAACCGCCCCGTCTCTGACCGGCCTCGACATTGACGATACGTCCGAG