Description :
From Genome Similarity Track
Location :
Scaffold_136:11522- 13202
Transcript NameFunction/comments
Physo_143331hypothetical protein

Sequence
1680 bases(100 bases per row)
CCTCCGTTAGTCGGTGTCTGCTGGTGGGAAGATCGATCAGACCTTAACCAGATTTCGGCTGATCCCGCTACACCACAATGGTGTGCGTGCCCGGATCTCT
TGGGGACTCCGGATTTCACCGTGAGTCCGTAGAAGATGCGCAAGTGAAGAAATAACCAGGGGAAGAGGCGCCGTCGGATATCGGATCGACGAAGACGCTG
CTGAACAAAACGAGATCCGCGGATCGACAGAGTGCTCGGAGGACTTCTGTCGACGGAATCGAGGGCGATCTGGAGACAGATCTAGAAGACAAACCTCAAC
ATCCTCCCCAGGTCCCTTCGGGGACCCCGGTGGATCTTGGTGCGAACCGATATTCACTAACAAAACAAACTAAGGTGGGATCGGACCGGTACGCGTTCGC
TGACTCGCCGATCAGGCTCGATCCGAACTACCTGGACGCGGTCGCGGACAAGGCCCAGGCCGTGAGGAAGAAGCTGAGAGCGCCAGGCTTGGACAACGAA
GATCCCAGACCGTCGGTGCTCGACTGGTCTGAGGCTGACCTGGATCGTCAGTATCACTTGAAGGAACTGCGAGACTTCTTGCGTCAAGATCCTGTCATGG
TGATCTTGCGGCCAGAGCAGATCGACGACCCGAAGGGCCCGATCTCGGCCCCCCGAGTGACGGACAACAAGCTGATGGCGGTGAAGAACCTGCTCGGGCT
GTTGAAGGAAGCCGCTTCGTGGCTGGTGCCTTTGAAGCGAACGATCTTTTCGATCAAGATCTCGATGTGATCTAGGCAGCGATCCAGACATTGGTCGACA
AGTTGAGACCTTTGGTCGACGTGATCGCGGACAGTCCGGACCCGAAGGTGCCAAATCTAGTGTCGCCAGCACCCACGTCGTCGCCGCGGATGAAGTCCAC
TGGGTACCGATCGTCGTCTCCTTATGTCTCCGCAGCGGAACATGTATCGGATACTTCGTCTGAACCTCAACGGATGTCCCTCGGACCTTCAGGATCTGCG
ATGTTGGACGCACGATCACGGAGTCAACGTCAGGAACGCATGCGGTCAGGACCCCGGAAGCAGAAACCCAAGTCGACCGATCGGACCACCAGTGCTACCG
GATCAGATGGGTCGAATGGCAGACTGGAGTCTTACTTTCATGCTGCGATGGCTCAATTTCTGAAGGAACAACAGGCCACGGTGGTAACACCTACTCCAGT
GGTCGACGACAACGTTGGATCGCGGGACGTGGAGATGGAATCAGCCGGATCGCCGGATCAAGTTCTCTCTCAGTGGGAATACGATCCGGACGACATTGAT
CTACCGCATTCGGCCCCTGCTGCGGTGGCCACCGCTGCCTCAGGATGCACTGGGTCCTCCTTGATCCAGCGTGTGCCGATTTCGGCGATGTCCGATCTTA
AGGAGTTCAGTGGCAAGGATCAGGACGAAGACCGCGCCCGATCGTGGATCAGCAAGGTGAAATCGGCGTTCCTGCGAGATCAGGCTACGGACGAAGAGAA
GTGCCTGGCCTTCGCCGATCTACTGACGGGCCCGGCGATGAACTGGTACCGCCAGCTGGGTCGATCGACGTGGAACAAGTGGAGCGATCTACTCCGGAGT
TTCCAGATTCAGTATTGTGGCCTGGGAGTATCGGTCGCTTGGCAGTATTATAATTCTCGCAAGAGATCAGATGAATCGCC