Description :
From Genome Similarity Track
Location :
Scaffold_48:115219- 116309
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_09738Hypothetical protein

Sequence
1090 bases(100 bases per row)
GCCAAGATGCTACAACTGTCGACTGGATCTACAGCCCAAGTGATCCAACAGCTACAAGCGCACGACGCGCACGGCGACGCGCGCGTGCTGGTCACGGTTG
GTAACATCAAGGAGGACCTACCTATGCGCCCAGCGCACAAGAAGCCCATCGCTCCACAGCGAGGCTCACTTTTGAAAGTGCGAGCGCGACAACAACGTCC
AGAACAAGCCCCAGCGTGTCTTTGACGAACTCTGCGCCAACATCCTCACGGATGATCGATCTCCATGGACCGCAACCGCGGGCAACACGATCAAGGTACT
CAAGGAAGGCCGCAAGAAGAACTTCGCTCTGGCACTTGCCGCCAGCCGTGCCATCGACACCAAGAACAAGCTTGCTGTCCACGCCCAACAGACCATGAAG
ACGTCTCCCGTCCCGACGAGCCCAGCACGGGTGCCGAACTCGTGCTCGATGATGTCCTCCACTACGTACCCTGACGTGCCCATGCAGCTCATTTCCACGT
CGCTAGTCGACGACAATGGTTTTTACCAGCTCTCGCATGGTGGCAAGCTGCTGGTCATGACGGGTTACCCGACGCTGACCGCAAGTACGAAGGTCGGCTC
ACTCTGGCCGCTCGACTGCACGGCGCCCAAGCCAACGACCGGCAACACGATCGCACGGCCGGCGTGCAGTATGCTCGTACACGTGCCGACTGCCTCGTCG
TACATGGACGCAGGACTCGGCGCGGCTCTTTGGGCATCGTGAACATCTTGATCGGTTTGGACATCTTGACCATCTTGGACATCTTGATCGGGCGCCTCGT
CACATGGGACGGGCGCAGATGGCACGTCGTCGTCGGACTCGTCCGGAATGGTGGTCGGGATCGGCAACGGTTCGCGGTCGAGCGGTTGTTGAAGCATAGT
CTCGACACGTAGATAGTGTTAGCCAGCGTCTCTCCAGCGTAGAACAGTAGAACAGTAGAACAGTAGCAAGAGCCGTCATATCTAGAACGATAGCCTAGCC
AACGGAGCCAGTCGGCTCCTTACTTGCCCTTTAACCACTAATCTACCTCATCCTCTTCGGGTAAGTCGGGCTCCTTCCTCACCGCGGGGT