Description :
From Genome Similarity Track
Location :
Scaffold_2282:1152- 3081
Sequence
1929 bases(100 bases per row)
GTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGTCTAGGGATACCGTCCTTCGCCAACCATCGCC
CGATCTCCTCATAATGGTCCAGTAATAATCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCTTGGATTACGGTAGGTACCCA
TTTCTCGCCCCGGGTGACCCACAGTTTCTCATGTTCCACCCACTTTAACCGGTCTGGCAGCTCCCAAGTTTCCCCGGGCTCGATCCAGGTGGTCTTATCC
GCCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCAGATCTA
ACCTCACTCCGGCTGGCACCATGAAATCCATCCCAAGGATGGCGTCTTGACCAGCGAGATCCCCGACCCAAATGTCAAACCAATACACCAAACAACCTGC
CAGCGTGATCTTGATCCGCGTTCTCCCGTTCGTACGGTACACGCCTTCACCAATTCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACC
TTACGAGCAAAGGGGGTATCTAGTATAGACACCTTGGCACCACTATCTAGGAGTAGGGTTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTC
TGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTCAGCAGATCCATGGATCCAACATCCTCAGATCCACGGGATCCAGTGAC
CTGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAATAACCACGTGCCTCTCCTCTT
TGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAACTCATCCACTTAGCGCAAACTAGAGACCTTGGCAACTGACACTTCATGTAGATCACGTGTAT
TATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAA
ACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTTCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATT
CTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCAACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACA
GACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGTGAACACCTGACTTGTGCTGCCCCGTCCATGAGATCTCGGGATCTGTAC
ATCCCACGTTCCCCGGGTACGGTATCCCCGGTCGAGAGTTGTCTCCTGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACCCGACGGTAATCTTC
AGGGTCGGAGTCCGAACCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCTTT
TGGCGATACTTGCCGGATCCGACCGCCGCCTTCCTCTGGCGGTATTTCGCGCGATCCATCGCCCGCAGCACTTCCTCAAGCTCGTCTGCGTCGGGAAGTC
GTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCACCGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTT
CAACTTGACCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAGCGGGGATTCATCCGATCTGCCGCGAGCGTGGTAGTATTGTCGTGCCACCGAC
ACTCCAAATCCACAGTACTGGGTTTGGAA