Description :
From Genome Similarity Track
Location :
scaffold_11:1152- 2506
Sequence
1354 bases(100 bases per row)
ATTGGCGCACGACAAGGCGGGTCAGGGTGGCATCAGATCATCCTTCGTCGACGGAATGTTATGACGGGCGAGCTAGTTCAATGAGTAATACAAAGATGAC
ACCGATCATCGTGTATTCACTGTCTGTTGTGTAGTGTTCAGGAAGCAAGTACAGAGTAGTGTGGTGGAGCGGTTCGGCAGCAATTGCTGACCGCCGGGTC
CGTCCGCTCACCTATGCCCCGGACTACCGACTAACGGAGGGGATATTCCGATCGTCCCCTGACGCTGAGATCGGTCTCACCTTGTGTACCCGTCAGTGGG
GCGGGTTGCACTCTTCCGGCGACTTGAAGATGACTTGATGGGGTGATCAGTTGGGGCTGTACGGACGGTACTCGAGATTTTTTGACAGACGCGCGGAATT
TTCTTCACGCGTCCGTCGGGTAGGGATTTAGACCAGTTTTGAATAGAACTTGATCAACTTGGGGTGTCCTAGGGTATGTCTTGGCCTTTCCGTAGCTTGC
CGCCCCCTGTGGTGGGGTCCTCTTGAGGGGTAGTTGTGATCGATCCTTGGTCAAGCCTACCAGGGGTGATCGTTGTCGTCTTCTCAGTCGGCCTTGTGGT
GTCTTGGTCGTCAGGTGGTTCCCAGCCTGGAATCGATGCCACGTGGCCTTAGAAGAAGGAGCGAGTCCAAATATGAGTTCTCCAAAGAATATTCAGAAGT
CCCTTTATCCCCTATCCTACTCGCATAGCCACTAGTTCCGAACTGTACCTAAGTGTACCGCAATGATCGTACCATTGTACCTACGTCAGCCTTGATTACG
CCCGTATCCGATGATTGGTACCTTACCTCTGTTGATCGCATTCTCTGATGATCGCAGCTCGACAGTTGATCGCATCTTGATAGTTGATCGCTCTTTTCGT
AATCATATATCCACTCGTGTATCTCGTAGACTACCCATCCGATAGTTGATCGCATTTTGTAGATCGAATTTCTAGATGGCACCCCAAAATCAGTACCTCC
AAGGTTGACCGCATTTTCGGATGTATCCATCTTGGAGTTGATCGCGTGTACCCATCTCAGAATGATTGTGGGTGCTCTGGATAATCGTATCCGAATAAGA
TGCGATCACATCCGTGGTCTCAATCCATCAATCGTCAGTCCATCACCGTCGCGCCCCGACTACCATTTCTCGTTTATCGGCTTCACAACAGAAGCAACGA
TGTAATCAGTGACAGTAGATGATTTTACTGATTGAGCGGTATGATATGCGTATACAGAGACTACAGACTTCGTTTTAGGCTGTCACTCAATGCATTAAGG
GAAAGTTGCTTTGGATAAGCAGGGCCTGGAGCAGGCACACGGCTTGCTCATGGC