Description :
From Genome Similarity Track
Location :
Scaffold_74:115189- 118178
Transcript NameFunction/comments
Phyci_526743myosinlike protein putative

Sequence
2989 bases(100 bases per row)
TCCTCCTGCAGAGCCGCCTTCAGCTTTTGCAGCTGGTAAGCCATGTCAGCCTCGCGGCGCTTCTCCTCGAGAGCGGCCAGGTACTTGGGCCGCTGAATTG
TCATGCGAACCACAGCCTGCACACGGATGACCATCGAGCGCATCTTAACGTAGCGGTGACGCTTGACGAAACCACGCACATACCGCTGGATGATGACAGC
GTTGTGGTTGCTCTTCACATCGGCCGCCACCTTACGGCCTTGAATTCCTCGCCAGTGAGCTTGCGCCTTCACAAGGCCGTTCAGGAACGTGTTGTATCTC
CGCATGGCAATCACGCAACGGATCACCGACTGCAACTTGATGATTGCTTCCAGTTGTCGGAGGTACTTGATACGCTGCGTGAAACCAAGCATGATGTTCT
GCAGGTACGTCGCCTTGGCGTCCAGGAACTTCTTGCGACGGTCCTCAAGCTCTTCAAGGACGCCAAGCTGGAAGTATACACGAGTCTTACCCATCTGGTA
CTGCGTGGGCGACTCGAGCTTCAACTTGTCCATAAGCAGCTGGCATTTTTCCGCCGCAGTCTCACCACCACTCGGCACAAACAGCCAGAACTTGTCCAGG
ATCTCAGTGTGCTGCAATCGGTTCGGGTACGCCGCGCGCGAGATACGAATGGCCTCAATTACACCTGCGCAGCGCAACTGAGACACCACCATGTTCTGGT
CCATGACCGTCGCACTCTTGACCGGGTTGGGCTTGATGCAACGCACGTAGTGCACACGCGTCGAGTTGATCGTAGCCATCAGCTCTGTCAGACTCTCCTT
GAACTGGGTACCGACGGTCGTGATGGACAGTGCACCGCCACGCTTTCGGCGTCCTCCGGACGCCTCCGGAGCAGCTTCCTTTGGCTCCGGCTTCGGCTCG
AAGAGCTTAGCGATGAACGGCTTGGACGAACCGCGCATGAGCTCGGACAGATCAGGCAGCAGCGAATCCTTGTGCTTCTCGAGGAAGCCCACCGAGTCGT
ACATGACCGGAGCGGCGTAATGCTTGATCAAAAACTCGGTGCGTGATGTGCGGGGGAACTCGATCACGTGCGCCATGTCATCCTTATGCAGGGAAGTAAC
CTTGGACATGAACGACTCCTCGTTACCCTTAGGACGCATCACTTCTTCGTTCAGCAACGAGATAATACCCATGCGCGACTCAATCACGGTCAACACATCC
TGGTTATCCGCGTACTCGATGTGGTCCCAAACAatgccttcctcctcgtactcgatctgcacggtcttgaaaacatcctgggtgaacttctgctgaagct
tctcgttggcgtagttgatgcagaactgctcgaacgagttgtgcttgaagtgttcgaaaccgaagatatcaagcacaccCACGTGGTTGGCCATGTTTGC
ATCATCGGCAAGCGACTGGTTAATCGTGGTCACGAGCCAGTCGAACACATTGGAGTAGATGGCCTTAGCGAGTGCGTCACGGCAGTCCATAGCCAGCTCC
TTCTTGAGCGGCACGCTGTAGACGTCGTTTACAGCGCGCATGGTGCGCGAACACAGGGCCGTCTGAAGGGCCTCCCACGTAACACCCAGCATCTGCGTAG
CAGAATTCGCGCCGCTGTCGCCCTCCGTGATGAGAGACTTCTCGTCATCCGACGGGTCGGACTGCAGCTGCATCTCACCAAGGTGCAGCACACCAGCCAG
CACCTCGAACAGCGGACGCTGGTCATCGCGCGACAGACCCACCAGCTCCAGCGCATCGCGCGTCTTGTTGAAGTGATTGGCGTCCGAGAGCCCCTCGATC
TTCTGGGCCGTGTTGTCGCCCGTGTACACGTAGTGCTTGCCCGACTCGAGCTGCAGCTCGGGGGCAATATCGGGGGAGTCcagcagctggtagaagatgt
ggtagttgcgctcgggcgcttcgtgctgaatgacacgcgtcttctccagcaggtaggtgcggcacttggcgcccacgagcgtgccgttcttgtcgaactg
cagctgcgtgaacttgccgaatcgactcgagttgtcgttgcgcaccgttttggcgttaccgaaggactcgagcagcgggttgacctcGATAATCCTCTTG
ATGGTCGAGTTGTTGAGACCGCCGGCGATGGTGGCCAGGTGGTTCATGAGGATCTTGGTGGTCTCCGTCTTGCCGGCGCCGGACTCTCCGCTCACGAGGA
TGGACTGGTTGCGCTCCGAGCGGCGCATGTTATCGTAGGCGGCCACGGAGGTGGCGTACACGTGCGGGGGCAGCTCCTCCTTGGGCTGGTTGAGGTAGCG
CAGGTGCTGCTCCTCCGCGTAGAGGTCTGGcagccacttgtacgggttcacggcgatgcagatgtcgcccgtgtacgtgtagggcAGCTCGCAGAGGAAG
CGCTTCTTGACGTTGTACAGGATGGCGGCCTCGTGCAGGTAGTTGAGCGTGATCATGTCCTCGATGCCCTCGGGCCCGACGTTCTCGTTCTGGTAGGGCA
GCGACTCGAGCTGGTGCACGGCCAGCAGCGCCTTGGTCTTCTTGGACAGCATGTCCACGCAGCGCTCCTCGGTCTCGCCGTCGGGCAGTTCCACCTTGCA
GTAGATGTTGCGCGTCTTGCCGTCGCCCGAGTTCTCGTCGCGCAGCACCTCGGCCGCGAGCCACACGTGCGTCTCGTCCGGCACGAAGCACTTGGCGCCC
ACCATCATCTGCAGGTCGCTCATGGCGTCTCCAAATCAGGCAGCGCTCGGGGCGGAGGACGGAGGGCGGAGCGGGTGCGCGGCTTGGGCGAAGGAAAGCG
GAATGCCACGACAGCAAGGGGGGCTCTGGCTGGGCAGGATACCGCGCGCGCAACCGGTAAATGGAGCCATGTTCTGATGTGGCAACTCAACTCACGTGGC
TTTTGTATCGACTGCGACTTGAAACCCTGATCCAGCAACTACATAGCCCGGACAGGGCAGCTGGGCACGGACAAAACCTCTGCGGCAAC