Description :
From Genome Similarity Track
Location :
contig_61:115182- 117870
Transcript NameFunction/comments
g10856.t1hypothetical protein

Sequence
2688 bases(100 bases per row)
CTTAACGTGACCACACCTGTAGTTGCTATTGCTATCCTATATTTAGCAGCGAAACCACATGTCCCCAGCCTGATAGCATCAGCCAAAAGCCAATTTGACA
CCGGTGGTGCGGCTATTAACTACGTTGAAGCTATGATTGATCGATCTTCGTCGTCTTGGTTGACGGACTTGCTTGATGAGGGGGATGAAGAGGGAGCTTT
TGTTCTGAATTTAGTGTTGTCTAAACCTAGAGGATTGGATTTGTCGTCGTATCCGGGTGGCTCGAGGCCAGGCAGAGCCGCAAACAAAGCTCGTCGAGCG
GCCGACCGTCATTTACGTCTTCTGCAGCAGTATTTTGGACCAAAACCAGTCTACGACTCATCAGCGTTCCGAAAGCGCTTTCGAATAACCCAACGTTTGT
TCACGAAGATGCTGATAGCAGTAGTTGAGACCGATGACTACTTCGAACAGAAGGCTGACGCTACCGGTAAGCTAGGCATCTCGAGTTTGCTTAAAACTAC
TGCTGCATTACGACAACTTGCACATGCGGCTGCTGCTGACGCGCATGATGAAAACTTGGAAATAGCGGAAACTACGGCATTAAAATGCTTGAAACGCTTC
TATCGTGCTATCATCGCGAGGTTTGGCAGTGCATATCTTCGGTCACCAACACCAAGTGAATTACAGGAAATTCTACAGGAAAATGCTCGCCGTGGTTTCG
TTGGGATGATAGGCTCTGTAGATTGCACGCACTGGCAATGGAGAAATTGTCCGACTGCACTGGCCGGACAACACAAAGGGAAGGAGAAAAAGCCCACTAA
GATTCTTGAGGCCGTCGCAGACTACAACTTACGAATATGGCACTGCAACTTCGGGTCTCCAGGTTCTCTAAACGATATCAACGTTCTGGACCAGTCTCCT
TGTTTCAAGATTTTCTGCAGGATACTGCTCCCCGTGTCAAGTTCGTGATATCTGGTATGATGTGCTTCTTCACATTGGCTTTCTTAATGACTGCAAACTA
AATGTGAAACTCGTAGGAAAGCCGTATGACACGCCGTACTTGTTGGCAGACGGAGTCTACCCTGCATGGCCTGTGTTTGTCAAACCTATTGAGAAACCCC
ATGGATTAAAACGAAAGCACTTCGTCAAGCGACAGGAAGCTTGCCGCAAGGACGTGGAACGATGCTTCGGTGTGTTACAAGCGCGATGGCGCATAATTGA
CACTCCCTGTCGTCTTTGGCGGGCAGATGCAATGGCCCAAGTGATGCACGCTTGTATAATCCTCGACAACATGATCATAGAAGACGAACTCAGTGATCCC
TATTGCAATGGGCATGAGCATCTTTACGATGCCGAGGCGCAGCCTGGTGGCATTCCAGTATTCAATATTGTTAGGCCACAACGACCACCGCGATCTTCTA
CAGTTGCTACGCTGATATCTAAATCGCACAAACTTCACAACGCTAACCAGCACGCTCGGTTGAAATCCGGTCTCACAGATCATCTCTGGACAATGCGCGG
TCTCGAAAACTAGTTAAAATTTGCAATATACGACCCTTGTGGTTTGAACTTAAGCAGTGCTAGATAATTAGCGATGATACAACATCGGGTGTTGTCGTTG
CAGTAACTGTGGGGGATGAGTGGGCTGCTGGAGTTAATGGCGCGGTAGTGATGGGCTCTGCTCTGGCTGGATCCGGCTGATCACCAAGCCGAGATCCATG
TCCTGCAGCTGCAGGAGTCTCTGTGTCAACAGCAGCAACCTCTTTACGAAGTCGTGCTAACACAAGTCGTCGTTTGAGCGCGATGAACTCCATCGTCTCC
GGGTCGCTAGTGTTTGTTGCCATGCTAAAAAGATTCTGATCAACTCGATCTTGAGCCACACGAACGCGAGCATCGGCTGTTTTCGCCATTCTTTCGGTGG
TTTGCACTTGTCTAGAGTAGAGAGCTAGGTTTGCGCGCTCCATTTTAGCACGCTGCTGCCCGATGGGCGCTTATCTTCTACTTCTGTTTCTGCTGTTGAT
GTACCATCGGATATGCTACTCCCGATACCGTCCACAGATTGTAGTTCAGCCAAACATTCGACTGCCGTCCGCTTCCTGAGAGAGGTCTCTTGGCGTTTCC
GTCTCGCCAAACGCCCCACTTTGGCGAGTCTTTCAAGATGCTCCAGCACTGCAAGAACCGGAATTTTCCGCTCTCAGCTTCGTACAGCTCCACAGCTTGA
TGAATGATGTCCGTTGGAGATCTACCACTAACATCCAGCCGTTCCACCTGCTTGAAGCAACCGACAAACTTCGACACAGACCGCGAAATTGTCTGGAAGC
GCGACTTCAGCGAGCCAGGATTTCTCGTAGTAGGAGTCCCTAGAATTTCTTCAAACACCTTTCTCACCTTGTGATACATGTCGTCTCCGGTCTGATTGAT
CCCAGTTACAGGATCACAGCTAGCATTCAGCCATGCCTCACACAAAGCCTTATCCTCTGCAGCACTGTAGTTCGCTCCTCGTTTCTCGGACATCTTGCAG
ACTGTTCACCACTCCGCTGGTGCTATTTTCAGAGACAAATTTAGCTCTAGATGTGGCCCCGATGGCCTCAAAGCTAAATCTGTTTAGCTTTTAGCCGCCC
CGGTGGCGCTGTGCAATGCTATCCTAGTGCCAAATCTGGCATTTTGGGGCGCTAATAGCACCCCGGTGTGGTCACTCTTAGTGCAACA