Description :
From Genome Similarity Track
Location :
contig_61:115181- 117875
Sequence
2694 bases(100 bases per row)
CTTAGAGTGACCACACCGGTAGTTGCTATTGCTATCCTATATTTAGCAGCGAAACCACATGTCCCCTGGCTGATAGCATCAGCCAAAAGCCAATTTGACA
CCGGTGGTGCGGCTATTAACTACGTTGAAGCTATGGTTGATCGATTTTCGTCGTCTTGGTTGACGGACTTGCTTGATGAGGGGGATGAAGAGGGAGCTTT
TGTTCTGAATTTAGTGTTGTCTAAACCTAGAGGATTGGATTTGTCGTCGTATCCGGGTGGCTCGAGGCCAGGCAGAGCCGCAAACAAAGCTCGTCGAGCG
GCCGACCGTCATTTACGTCTTCTGCAGCAGTATTTCGGACCAAAACCAGTCTACGACTCATCAGCTTTTCGAAAGCGCTTTCGAATAACCCAACGTTTGT
TCACGAAGATGCTGATAGCAGTCGTTGAGACCGATGACTACTTCGTACAGAAGGCTGACGCTACCGGTAAGCTAGGCATCTCGAGTTTGCTTAAAATTAC
TGCTGCATTACGACAACTTGCATATGCGTCTGCTGCTGACGCGCTTGATGAAAACTTGGAGATAGCGGAAACTACGACATTAAAATGCTTGAAACGCTTC
TATCGTGCTATCATCGCGAGGTTTGGCAGTGCATATCTTCGGTCACCAACACCAAGTGAATTACAGGAAATTCTACAGGAAAATGCTCGCCGTGGTTTCG
TTGGGATGATAGGCTCTGTAGATTGCACGCACTGGCAATGGAGAAATTGTACGACTGCACTGGCCGGACAACACAAAGGGAAGGAGAAAAAGCCCACTAA
GATTCTTGAGGCCGTCGCAGACTACAACTTACGAATTTGGCACTGCAAACTTCGGGTCTCCAGGTTCTCTAAACGATATCAACGTTCTGGACCAGTCTCC
TTTGTTTCAATATTTTCTGCAGGGTACTGCTCCCCGTGTCGAGTTCGTGATATCTGGTATGATGTGCTTCTTCACATTGGCTTTCTTAATGACTGCAAAC
TAAATGTGAAACTCGTAGGAAAGCAGTATGACACGCCGTACTTGTTGGCAGACGGAATCTACCCTGAATGGCCTGTGTTTGTCAAACCTATTAAGAAACC
CCATGGATTAAAACAAAAGCACTTCGTCAAGCGACAGGAAGCTTGCCGCAAGGACGTGGAACGATGCTTCGGTGTGTTACAAGCGCGATGGCGCATAATT
GACACTCCCTGTCGTCTTTGGCGGGCAGATGCAATGGCCCAAGTGATGCACGATTGTATAATCCTCCACAACATGATCATAGAAGACGAGCTCACTGATC
CCTATTGCAATGTGCATGAGCATCTTTACGATGCCGAGGCGCAGCCTGGTGGCATTCCAGTATTCAATATTGTTAGGCCACAATGACCACCGCGATCTTC
TACAGTTGCTACGCTGATATCTAACTCGCACAAACTTCACAACGCTAACCAGCACGCTCGGTTGAGATCCGATCTCACCGATCATCTCTGGACAATGCGC
GGTCTCGAAAACTAGTTAAAATTTGCAATATACGACCCTTGTGGTTTGAACTTAAGCAGTGCTAGATAATTAGCGATGATACAACATCGGGTGTTGTCGT
TGCAGTAACTGTGGGGGATGGGTGGGCTGCTGGAGTTAATGGCGCGGTAGTGATGGGCTCTGCTTTGGCTGGATCCGGCTGATCACCAAGCCGAGATCCA
TGTCCTGCAGCTGCAGGAGTCTCTGTGTCAACAGCAGCAACCTCTTTACGAAGTCGTGCTAACTCAAGTCGTCGTTTGAGCGTGATGAACTCCATCGTCT
CCGGGTCGCTAGTGCTTGTTGTTCATGCTAAAAAGATTCTGATCAACTTGATCTTGAGCCACACGAACGCGAGCATCGGCTGTTTTCGCCATTCTTTCGG
TGGCTTGCACTTGTCTAGAGTAGAGAGCTAGGTTTGCGCGCTCTATTTTAGCACGCTGCTGCCCGATGGGGCGCTTATCTGCTACTTCTGTTTCTGCTGT
TGATGTACCATCGGATATGCTACTCCCGATACCGTCCACAGATTGTAGTTCAGCCAAACATTCGACTGCCGTCCGCTTCCTGAGAGAGGTCTTCTTGGCG
TTTCCGTCTCGCCAAGCGCCCCACTTTGGCGAGTCTTTCAAGATGCTCCAGCACTGCAAGAACCGGAATTTTCCGCTCTCAGCTTCGTACAGCTCCACAG
CTTGATGAATGATGTCCGTTGGAGATCTACCACTAACATCCAGCCGTTCCACCGGCTTGAAGCAACCGACAAACTTCGACACAGACCGCGAACTTGTCTG
GAAGCGCGATTTCAGCGAGCCAGGGTTTCTCGTAGTAGGAGGCCCTAGAATTTCTTTCAAACACCTTTCTCACCTTGTGATACATGTCGTCTCCGGTCTG
ATTGATCCCAGTTACAGGATCACAGCTAGCATTCAGCCATGCCTCACACAAAGCCTTATCCTCTGCAGCACTGTAGTTCGCTCCTCGTTTCTCGGACATC
TTGCAGACTGTTCACCACTCCGCTGGTGCTATTTTCAGAGACAAATTTAGCTCTAGATGTGGCCCCGATGGCCTCAAAGCTAAATCTGTTTAGCTTTTAG
CCGCCCCGGTGGCGCTGTGCAATGCTATCCTAGTGCCAAATCTGGCATTTTGGGGCGCTAATAGCACCCCGGTGTGGTCACTCTTAGTGCAACA