Description :
From Genome Similarity Track
Location :
Scaffold_84:115160- 132575
Transcript NameFunction/comments
Phyci_234803ABC transporter lipid export ABCA family
Phyci_95141Hypothetical protein
Phyci_95142Hypothetical protein
Phyci_95143Hypothetical protein
Phyci_83218Hypothetical protein
Phyci_95145hypothetical protein
Phyci_537843conserved hypothetical protein
Phyci_95146Hypothetical protein
Phyci_234922Hypothetical protein

Sequence
17415 bases(100 bases per row)
CACGGCATCCTCCAGCAACCACCAGCTAGCAAATGACACTACGTCAATGGAACCATTGTCTCGGTCGCCGAGCTGGGTTGACAAAGCAACAGCAACATTG
TCCGCCCGCTTCGCATTGCCGAGGACTGCACAAGCCCCAGCAAGTTGTGCAGCGGTTATTTGAGCACCAGTTTCCTCTGCACCAGGATTTTGAAGATGGT
CGCACACAAGGTGCGTTAAATCTGCAACTGCGTGCAAAGGAGGCGCCTCCATTTTGCATtcgagcatgaacccgtcgccaaaacgcgctttcagatgcgg
aatactgccaaagcagcgcaggccaccattaaccataatgccggccttgctgcagagagcctcgcactcttccattgaatgagttgtcagcatgaccgtc
gaccgtcgtgtttgcaccgacgcctccaaaatgacatcccatagcaaacgccgcgagaacgggtcaacaccagtggacggctcatctagtactagtacgc
tcggctcgccaatcatggcgatcgcaagcgatagcttacgtttgtttccaccactcaaacttcctgcaagtttgttagcgaaagcttggatcttgagttt
gttcatcaagcgatccacctccttctggagcctttcatgatgaaaacctttaaaccggccaaagagctctaaatgctcgcgaacggtaagcaagtcaatc
aatgcatcaaactgggggcagtagccgatcgactctcgagcttggcttcgttccttgcgaatatcaaagccattcagagtggcagtacctgaggttggca
ataagtcgcctgtgaggaccttcattgttgttgtcttcccggcgccattcacacctaaaaatccaaaacattctccttgttgtagcccaaacgagagctt
tttcacggcacgtttgccgtttggatacactttTTCAAGCTCAAATACTTGGACAACTTCTGAGTTGGCATCCAACGCGTGGAAACTTTCGTGGACACGC
TGAGCTTCCATAACAACATCTTCGTCAACGTCGTCACTATCGATACATTTGGCATCTGATGACAGTTGAATGTGGAGTTTGGCGCTGTTGCAAGGCACAC
GTGTGTAAATCCGTCGCGCGGAGTTGATTTTGTCCACGAACCGAGACATTCGCCAGCCCACTGTCCCTGCTTGGACTACGTCGACTCCGATGGTTAGTAA
GATGAAAACTGGACACTCGATGAGCAAGTACCAAACATCCGTGCCAGCAATATCTGCGTCGAACGCACTGCGGGTCTGGCTGGTAAGCCCATAAGTCGCT
AGCAGATCGGCGAGCAATATATTGAGAAGGCCATTGCCAAGCGCGAACAGTGGTGAACAGCGCCAAATGTAGACGAGCACATCATTTGCTGCTCGAGTTG
AATCTAGAGAATTCATGGTGAAACTCAGAAGCAACAGGAGAAGGCCCAAGAAAAAGTTAATCATGACAGTGTAGAGCAAACACTCGCTGGGTTTCTCCAT
CACATGAGAAAGCAGGTACGTCCACGGAGCAATAGCAGTACCGAAAAGCACAAAAAGCGTGGCAGTGGCAACTGGAACGTCTTGTGTGCATGATGCACAA
GACTCGGCGCCACCTAGTGACGAGGTAACACCATAAGATCCAAGAAGCAAAATGGCAGCGGTCATTGGTATGAGATATACTGCCACATCAAAACAAAAGT
TTGCCAACCAGTATGCGAAGAATGACATCCCAGACAGTATTTGCTGGTATTTGGCATTCTGCTCCAGATCCTTCTCTTTGACGATGTAAGGCATCATCGA
GGCAGGTATGAACGTGAAGGCAATTACGATAAAAACCACAGCGGGGAAACTAAGATACGCGCTGAAAATCGACCGTGTCTTGAAAGAAAGTGGTAGTGGA
TGGGAGAATACGCGAAGTGTCACGTTTGAACTCGACTTCCCAGCTTTAGAGAGCAGAAAGCGGTTGATAGCACTATCGATCATGTGCTTATAAGTCGGTG
CGGCGTGCGTCGACGACCCGTTTGCCAAGACGTTGTAGCCCATTGTCTTAGTATCTTCTGAGGCATACAGAAGAAACCCTCCAAATTGCCCCTCTACAGC
AAACTGTGTAGGTTGAGCAGGCAGTTCATCATCAGATGCGTATCCATATCCCTTTTCAAAGACCAACTCGGCAAACCGAAGACCATACCCGCTCGTGTCA
TTTGGCTCGATCGAAGGTGAATCATAAGAAACTCCGAAAACAGTAGGTGTTGCGAATCCATCATATACCGTCTCGTTCATTTCGACCTCGTACGCTGCGC
CGTCCGAAAAATAAGCTGGAAGAATCAATTCGGAGTACCACCCGCTACTTCCACTATTGGCGTTGAGGTTGCGAGGGCAGCCGAATGGGACTGGAGTTCG
TTGTGCAAGTGAGTACTGCACAGTTGATGAGAGTTCTAGTTTTGGATCGTTCACAAGCACCGCACTGTATTTCAAAGCCGAAAGGCCGACGAAGATGGCG
GCAACAGGGAGAACGGTGCTGAAAAATAGCATGTTTAAGTCACGCTTGCCGCACTGCACTCTCTTGCGAAGCAGTGCTGTCATCTGGTTCGCAAACGTTT
CAATCACGCGGAGTGGTGGGGACTTCGCCGACCCACCAGCGACTTTCATGTTGTTTGTCGGAGACCGAACTACGACCGCTGTTTCCCAGGTCTCTACATT
CGGCAATTTGTCGGGTGCCAAGCTCGTAGTTGTTTTCTCGTCACGGAGTACTTCAGACGGTAACATTTCTGTACTACCGCTTTCGGCGACTTTAAGAAAA
ATTTCTTCAAGTGTCGTGACGGATATGGAGAAAGAGAGAATGCCCAGTTCGTGTTGACGGGACTCCAGGTCACAAAATAATGCTGGGAATCCGGCTGACG
CTTCAAACGGAAGTTGAAAACTTAGCTCCGTTCCAACATCTGACGCGACAATTGCTTGAGGCACATGCTGTTGAACCAATAAACGAGCAGACCGAGCATG
TAAGGCAGTGTTAGCTTCGCTCTGCCGAACGAAACTGAGACGgtagcccacaccgaatcgctttttcaggaatagcgatgaaccaacgcattgaagcctc
ccctccgccatgattgcgatccggtcgcccaaaatgtctgcttcgtccataaAGTGAGTCGTTAAAATGACGACGCGGCCTGCGCGGTTGCGCTGGATAA
GCTCCCATGTACTGCGCCGGCTATACGGGTCCATGCCTGCAGTTGGCTCGTCCAAAAAGACCACCGTGCTGTTGCCCAAGAATGCAATTGCCAGGGATAG
TTTACGTTGCATTCCACCTGAAAGAGCATGTGATCGGACATGGATCTTATCGGATAAGCCCACTTCGTTAATCTTCTTGATGACTTCTGCTGCAAGATCA
CTTGCATTTGTGAATCCCTTTAGACGACCATAGAAAGTTAGATGCTCTTTCACGGTCAGGTCTGGGTAGAGTACGCTGTGCTGAGGACAATAACCAAGCG
ACTGGCGGATTTTCCTCATATCGCTAACGACAGAATGGCCCCGGATCCAAGCACTTCCGCTGGATGGTGGCGTCATTCCAGTTAGCATAGACATTACTGT
GGTTTTTCCTGCCCCGTTGTGGCCTAGAAGGCACGTAATTTGGCCTTCATAAAGCTTCAAATCTAGTCCGTGAACTGCAATTTTTTTCCCGCCGGGCACT
GAGAATTCCTTTCGCAAGCCTTTAATGACCACCGCACGACCACTACTTTCTTGCTGTTTCAAGTCTAGCCGAATAGGTTCCACCGTATCATTGACTTTAT
CTACCTCGCCTTCCGCTTCGGCGGAGACAAGCTGAGAGGCATGTGGGCACCAATACGCTTTTGACAGCAAGAAATACCACTTCTCCGCTACACCAAACTC
TTGAGGAACAACTTTCTCGAAATATTTACCAAGTAGAATATAAACCACCGTGTCTAGAATCTGCATCCCAATAGCATTTGCAAAGCGGAAGTTGTTTACT
TCGTCGTTCGCATTGTCACCTGTCACACCAACGCCAAACGATTCCAGCTTTGCAATTACTCCAATGCCTTCGGACAACGAAATTGGCGGGAGGATCCCCG
CGCACGTTCGACTAGCTTCGCTAGTGTCGTCATTAAAACTGTACGAAATGAAAAACATCATAAAGAAGAGACCCATACCCGCAAGCGAACCTGCTCGTGC
TCTTGAAAACAAGCTGCTTATCATAAAGCCGTAGCTGAAACTGCTCGTGGCGAAAGTAAAGAAAAACACGAACAGCAATCCTGTATCCGAGTTAGGAAAC
AGCATGCCGTGCGCGCCGACAGTTTGCAGGAACGCTCCCAAAACTAATATGGGCAGGTAAGCAAGTACCCAGCCACCGAAGAGCTCATTATCCCGTGCCC
CAAGAATTCTCATTAGCTCTCGAGACTTTGTTTCCTTTTCCATAAGGAAAGACACGATAACACGAGATACAAGGTACAAGTAGGACAGGACGAAACCTAT
GGGGAATACCAAGGCAACCTTTTCGAAAAAGGGAGCATAGCGAAAAGCTTGTGTCGGATTTCCATATACAGCCGCGCCGTGGTAAGGCTGTGGTGCCATT
CGCAATGGTACTAGCAGCGCTTCCCTGCCTAGTGGTGGTATTGTATCAACGGAGACGTTTGGTATAGTCACGGAGACAGCGCTAGTAATCAGGTCCTTCG
CTGAGTTGAGCAAAGTAAAAGCAGTACCAATAATCATGTCATTCTCAAGTTGCTTCAGCAATCGACGATCAGTGGTCGCATTTGCGGGCATTACGGCCAG
AGAAACCTGGCATGTTCCGTTGGTTGTAGAAGACTGTGCGTCCCAGGTTGGCATGCAGTTGAGAAAGCGTGCTACTACCGTCTGTAGAGTCATGAAACCT
CGAGTTGCATAGGCCATGTTGTTTCCCGCTGGTGCAAACTTCGTGATGGTGTTGGGTCTGGGTTTATTAGTATTTGGTACAGGCGCAAGATTTCCAGTCG
AATTGAAGCGCAAAGAATATGCAATTGAATGACCTCCCAAAGCACCGAAGGTCAAAGTGTCCTGAGGAAACTCATCAAAAGCAATGGCAGCGTAGATCTT
TGGGTGCTGGACGTCGGCACCGTATTCCTTACTGGACACGTACTCCTCCAAAGCCGTCTCATTGTCGAAAAATACGTGCGAATCAGCGAAGCTAGGAATT
GTCAAAAGTGAGATACCTTTCACGACTGGTGCCAATGCAATGCGTGGATACCACGTTTCCAATGCCGCGGCGAAGTATTCTCGTGTATATGGCGTATCAG
GAGTGATTGCAATCTTGTACGGCACGACTTTGCCTTGACACGTGTTGGGTACGTGATAAATGGTGCGCTCTGCTCCAGTATAGCCAAAAAGCAGAAATTT
TAGGGCACAATCCATCAGTGCATCTTCTCCTAGTTCATCGAGTTTGTCCCCTTCCATGAGAGCTTGCAGGGATAAGCTCAGCAGTAATCCAGCCATAGTC
GTTTCCGTAAAGTAGAACCTGGGGATCTTTAGACTACTGCTCAAGATTCCCAATAACGCACTCGCTGAGACTGTTCCGTTCGAGGAACTGTTGCTGCCGC
CGCCACTTGTAGACTCCTTTGGAACAACAATGCCCGCACTACTCAAACCATCATTCAATGCCGAGTTGAAGTCCGTCATCGCGTAGAGATTCCAGGTCGA
ACCGTAACCCGGTGCAGACGCATTCGCATCGCTGGTCGCCCATCCCGCCGGGACGTTCAAGTCCGCTTCAAACTTCTTCAGAGCCACGAACAACAGAATG
CACAGCAGCGGGTTCAGCACCTCGCTCCACGTCGCGAACGGATGGCGTCTCTTAATCATCCAGTTCTTCGCCACCAGTGCGCGCAGCACTGGCCACGTGC
GTCTTGCATTCTCTGCCTTCATCCACCTCCACCGATCAAAAAGCACCTCTCGGCAAAAAAACTGAAATGAGCAGCAAACAGTAGAAAGCCATTGAAACGG
AATGGAAAACGGACGGACGCTCCTATTCCTAGTCTACCCAACATTGTCCCCGTCGTTATCGTCCTCTCACTTCTCGCCAGCAGCTTCCTTCGCTTCCCTC
TTGGCCTTCGCTGCTGCAATCTGCATTGACAGTGGGAAACCGAAGGCGAATAACATAGTAATATAGTAGTACAGTCAGCCTGGTATATTCGGGTATAGAG
GTGCTGGCTGCGCTTGCCTTGGCTGCCATGGCCTCTTTGCGGCTGCCGAACTTGCGGTTCTTCCCGTGGATGCGGCTCGCCTGGCCGCTGACAGTGGTGG
CAGCGATGGCCTGCGCCGCGGTCTCCTCGCACGCCTGCTTGAGCTTCATGGCCACGCGCTTGTGCTGGATGTCCGCCATCGTCGTGCAGCAATAGTGGCG
ACTGTCGGACCATTTAGGTATCCGAAATTAACCCCGAAAATAACGTCTGATATCCAAAATTGATTCATGACGTAATCAACGCTTTTATTGTCTTCAGGGG
ACACAATATTGTGTAGCCATGATATAATATGTAGTCCAGGACTACAATTCGAAACGTTGGCGGCGAAGGATCATCAATTGCTAGAAGGGAATCAATCGTC
ATGACGTCGCTGGCTCGGGGCAGCGTCTCCTCCGTCAAGAAGGCCGCGTCGACCGCGGACGGTGCGTGACCGTGTCAAACGGTTGGACGCCCATGTTGTA
CAATGCTAATAGCAGCGTATTGCAATGTGCTTGTTGCGGTGCAGCGCCAATCTGGAAATCATACTTGGCCGTCCGTTCGCCCAGCGCCAGTGAAGCCGTC
AATACTACGGACCACGTGAAGACAAGCTCCGGCAACAGTATTTATCGCAGCCGGAAGCGGTCGAAGCCGTGTCTTGCTCGAGGAGGAGCCAATGGACCAG
GAACAGCCATATGGATGTCGCTGGCCTCGCCATTGGCGACAACGCGACGCAGCGATCATGGAGACGGAGACGACAGCACTGCAGTGCTGAAAAGCATTCG
AGGATATTGGGAGCAGCTCAGTGTGAATGAACGCCAGCAGATACTGTTCTTGGATGAACCAGAGCTCGTGAAGCAGCTGTACAAGCTTAATCTGAGTCTG
CTTTGTGTCGGGCTAATGCAACGCCACCTCAAGACTACGAACCGAACGGCTACAGATACGTCTGCGGCCAGCAAGAAAACAACAGCAGCGTCGGCAACCA
CGACAGAAACAGTGGTGCCGAAGGTTGCGAGCTCAGCTGCTGTTCCAATGGCGCAAGATCGAGCAGCTACGCCGTCACAAACGCGTGCGGTAACAGATAC
CTCATCAGAGAAGACATATGAGCTGCTGGAAGCGATGGAGTTTATGGATATAGGCACAGGTGCGTAGCTTAGAAGCTGTGTTACAATGCCGCTAAGGTAT
TTTTGCTTACCACGCTTTTGTTGTGCTGCTGTAGGTATTTTGACGGTTAAAACAGAGCTGGCCGAGGACACCGCTCGACTCTTCACGTTGGTGGGGGAAG
TACTGGCAGGCTTCCTGACGTCGATTCATGTTCTCACAGAGAGCAACTTCACCAAACTCTTCGTGACCGAAAGCGAAACGATCAATACGTGGGCAAACTA
CCAGCGCTTAATTGGAATGCTAGTGGAGCAGGTAAGCCCGAATTGGTCCTCGTGCTAGGTATCTTTGAGCGTCACACTAATTTCTACGGAATAGCTTATA
TTACGGAGTTATGTAGGCTACTTGGAGAAAGAAGCAGCTCAGCAAATGGAGCAGCTATTGCTGGAAGTTTCTCTGGAAGACAAAGCTACAGGGCACATCA
CAACAGCAAGCAGTTCGGCTTCTAACAGCaagaagaagagtaaaaagaagaagaagaagaaATCGGCAGTGCATACCGCTTCAACTCTCCAGCAGACCCA
TACATCAGAGCTTCCCAACAACGAGATGGTGGATCGACCGGAGGGAGATGATTTACATGGCGTGGTTCCGGACGAAGAACCAGTCTCGGAGCCGATGCCT
GAGTCCACTGCTGCCTCCCTAGACAGTGATTGTCAGTCAAATTCATCGACAGCACCACTCGATGAAGCTGAAGCCATACTGGATGATGATGAAGTCGCGC
CTACAGAAGCGGAACTCCCGTCAAAGAAGTTGTCAGGTCTAAACCCCAACGCACTGGTTTTTCAACCTCAAGAAACATTTCCAACCGACGAAGACTTTAG
CACGCGAACGGCTTTCGGTGGCAAGAGGAAGTTTGACGAGTACATTATCAGCGTTCCGTTCGAAGATATTATCAGTGACGCCGGCATTGCTTTTGACAGC
ACAAATATCGATGGGGGGTCCGATGACGAAGATGCCGTCGAGAGTGTGCATGATCGTGAACGCCGTCGCTGGAGAAAGCAGCGTCGCTGTGAAGAAGATG
CCGAACTAGAATGGCAGTTGCAGCAGGTTTACGCGTCGGCGTCGTCTCTCTTTGGCTGGGACTTCACGAGGCAATGCGAGCTGCCGGACCCGGGAGCCAA
TCTTCCGTGGAGCGAGTCGACGTTGTGGAGAACGGCACCAAAAGAAGTGGTGCGGTACTTTTCACCCGGTAACGGCGACGCGTACTCAACGTTTCAAGCC
CCGCACTTCCTGCCAGCGCCTTCGGGACCCCCGCCATCGCGGTACTACTTCAATCCAGGTCCGCCGATGCCGTTCGGGCCACCGATGCTGCCTCCTCCCA
TTCCACAAGGCGCTTTTGGCTTCCCGCCGCAAGAGTTCCCCATGGTCGTCTCGTCACCCGACTTCTCCAATGCGCAGTACCACCCGAGCAACCACGAGGA
CCAGGTGGACGTTTGAAAAGCGTCCTCCAAAAAATCTGCGACGTGTGAGAGAAGACACAATTATTGTTCAAAAATCTATTTATTTCAGCATCTCCAATAT
ATTGTGTGTACACTCAATCTCGTACTTAATGGTCTGCGGCTTTGACTGACCGGCACTTGTGGTCGAGAGCCTCCAAGAGCTCGAGCAACTTTACTTGGGA
CCCAGCGACATGGCTCTGCTGCTGCGTAGCGTGACTTCCGTGGCCGCCAAGCGGGCGACCGCCTGCGCACTGGCCGAGGCCGCCGCGACCTCCACGAGCG
TGCGCGGCTTCGCGGCCAAGAAGGACAAGAAGAAGGGCAAGAAGAAGGGCGGCGACGACGCCAACTTCGAGCAGATGCTGCGCGCCATCAAGGGCCAGTA
CCCCGAGGCGTACGTTGCGGTTCTTGGGCGATAATACAATTAGCGAGGTGAGTGGCAGTGCTCTAATTGGTGTATTAATATGCAATGCAGGGACGAGTGG
ACAGAGGAGGAGAAGCAGCGCCACCAGGAGATCGGCCGCCGCTACAACATGATGACCAGCATCGAGCACAACCACTTCATGCGCGACGTGCAGACCAAGA
TCGACCTCAAGTGGGAGGCCATCAACGCGCTGCCCGCTGAGCTGCAGGCCGAGGCCATGGAAATCGACCTCGCTCCCGCCCCTGAGGAGCGCGGCATGGC
CACCTGGACGCCCCCCATCCCGGGCTTCCGACGATACACGGACGAAGGCGCCGAGACGATGGACTAAGTCGGGTTTAGGCCACAGGTTCACTGAGCAGGT
TACAGCCGTCGATATGCAGAGGATGCGGCAAATAGAACGAGGTGGAGAGTGCAGTGCTGCAAGAAGTTGTGAGAGGGACTATGCTATACTGATGTTTGGC
GTGATTTACATGCTGTGGGGATCGCGTTGCACTTCGTCACGCAGTGCTTGCTCGTAAGCGTCTGGCGGTGGCAGTGCTTTCTCTTCTTCTGAACTATCTT
CTTCCTCTTCGATGTCGGCGACTTTATCGAGACTTCCTGGCCGTGTAGCTCCGGGTTGCTTGTTCCACCACTCGCGAACGTTGCGCTGAATCACCAAGGA
CGCTAGTGCATGCGCCTTCATGCGCGCAAAGTTTTTGCGACACAGCACACCGCGTGTGGCAGCTTGGAATTTGATAGCAACGTGTTTTGTCTGCAGGAAG
CTGCGGCGAGCGAGCATACTGCGCGTGGCCGCCTGGACGGTCACGGCGGCACGCTCACGCTCAGACAACTCAGTAGCCTCCATGGAGCCATGATCTGCAG
CTTCTTGCTGCTTCTGCTGATCCTCAATGGTTTGTGTTGCTTCACGGAGTTGCTTGGTCGTTTCGCGCATGTTCTTACAATTCCTCTTGAGCAACCAGGC
TCGAATACCGTGCTGGAGAACCTTCACTTCGTCTTCTAATGACTGCCTTTCCTCTGGGCCCATGAGCTCCATAGCTGCTTGGAGCTTGTTGAGTCCTTCT
TCATCTTCAGCAATGACACTCTGGACATCGGAGTCGTTCTCTGTTCCAGCTAGCATTAATCGACCACCAACAAGGTTGTTGTCCATGCCAACTGCACTTG
CTGGGGATGAACCGAAGCCCGCTGATGTTCCCGTGCTGCTGCTGGGAGAAACGAGGATTTCATCTCCAACACTACTTTCACGACGACGAGTGGTGTGCCC
AGCCGAGTCTCGTGATATACTCAATGAAAGCGCGCATTTATCGTGCAAACTCATGGTTGAAAAGGCACCGAGCAAGAGCTTTCGATTGTGTTCCTGATTT
TCTCCCACCTGTGGTTCAACATCCAAAGGCAAACCATTCCAGTCAGTACCGCATATTCAGCATCAACAAACTACCCGTCGACAACTTACGTATGCTGTTG
ACTTTGAATATAAACTTGCCTCGCACGGACTCTCACAACTGTCGGCATGGGAACGTGATGGACGGGCATGGGGGACCACACGACTATTGCCTTCTAAAAG
ACCCATGTCTCCAGCATCTATGTAGGGTGTCGGGGCATCATCAATCTCCATTGGTGATCCACCAAAGCCATAAATCTCATCGACAACCCCCATGTCGCTA
GAAGTGTCATCTCCCATGTGGTGGTGCAACTTCGCAGCAACATCGGCGTGACCTGATTTTTCTGCACGTTCGGCAGCAGTGAGCCCGTCGAAGTCGCGAA
CGTGTAAATCTGCCCCGGATTGCAGTAACACTTTAACCACTTCATCGTGGCCGCACCCTGCAGCTAGATGAAGCGCAGTCTGTCCTTGTGTACTTTGCTG
GTTAATATGCGCACCATGAGCAACCAGTACTGGAACTAGCTGTGAATAGTTGTAGAAGCTCACGTAGTGCAGTAGGCTCAGGCCGGTTTCGTCAAGCGAG
TTGAGCTCCTCCAGCAGTTCTTCGCTCGTGTGTGCAACCGTGACAAGCTGACGCACTACGCGCTCCAGTAGTTTCTCGGAGAGCTGTTCCAAATCGTTGT
CGCTTAATGCTTCAATTGTACAGTCGTCTAACGCGATCGATGCTCCACCAGATGAAACCAGTGTGGCTGAGGATTCTCCAGACTCACCCGACAGTTTTTC
TTGACTGGAGTGCTGAGTTGACAGTCCTGAGGATGGCAGCGCAGTTGGTATGGACAAATTGTGCTCGGCTTCAGATAATTTGCTCTTCTCACCGCTACTA
CTTCCAGAAGCAATCGGGTAGGCTGCTGTATCTTTAGCAGTAGGCTCTGCTGCTTTCGTTCGTATTGCATGGTGAAATTCAGATAATCGTTCCACAACTC
GAATCTTGCATTGCCGCTCGTCCACTAAGCAAAACATACCGTCAACGACAAGAATGAGCACCTAAGACTGAGAATGGGTAGACGAAGCATGAGCATCAAC
TTACAATCTGACTCGACGTAAGACGATAGGTTCCTATTTGACCCAGAAAGCCTGTCCTCCGATCGCTTGGGGTCTACAAAAGCTCGCGATATTACAGTCG
GAGATCGGCCACGCTTACCAGAGACGCCATGCGCAGAATATGGTGCTGTAAGCTCCAGCGGGTCGACAACTGCTGACTCGGAGATACGTCTTTCCTGCGC
AATCTCGCCAACAAGTGAAGGGGACACTTGGTAATGGCTACGATACGTGAACTGTTTCTTGCGTGACAACTGAATGCAAGCCTGATGTGACGGTCCGCCC
AAATGACACACGTAGATGTCGACACTTCCAAGTTCACGTGAACTAGGAGCTGCGGAAAATACCATGCGCAGGGAAAAATTGTTCGTGCGGTTAGTGTCGA
ATCTGTAAACAATGAAGCAACTCGTCAATGCAATGAAAGACGCACCAGTGCAACGAAGTACAGTATCCGAGACTTTCTCCGCGCGCACTCGCTTGGCACC
AAACTGCACAAACAGTTTCATGGGATCTTGAGCCATTTTCTCTGGAAGCCTTGCTGCGAGGCAAATTAAGATTTTGGCTCCGCCATCTCCGAAGTCCCAA
TCTGGCGAGAAATCTGAAATTTCAGCCAGCTCGAATGTCTGCTGGCCCCCCAGCCCACATACACTCTTCTCCAAGGACGTAGCAGAAGTTAGGTCATTAA
AAAAATCGTCTGCACCAAATTCTGTGGTAATTCCTTCCATGACGTTGTCCTTCAACAGTAGTAGATCCGCATCCGACAGGTGAGTCGCTGAAGCCTGATA
TGACGTTGTCTGGGGCTCAAAGTCCATTTCGAAGCAGTCTGAAAAACGAAACACACAACCAAGGTTAGAATAAAATGACGTCGTGAACGTTGCATTGGCC
GCCTGCATACTTTTCATGATGGATTCCACCGTCTCTTCAGAAGCCAAAGGCTTGGGCGGGCTAAGTTGCCTCAATGGCAACACCGCACTACTAAAGGTGC
TGCTAGTTTGTGCAGCAGGCAGCGACCGCTTAACCCCCTTCATTACGCTGCTCTTGGGTACATCAACGGGCAGCTGACGCCCCATGGCTTCCTTGTTCAT
CTCGTCAAAGTAATGAACAAGAATAATGTTTTCCTTTGAATCACGCACGGAGTATATTCTCCGATGGAACGTCTACAGCACACAGTTCGTCAGCAACAGC
AACGTCTCGTATCATACCGATCTTCTTCATCTTCCACTTACTGAAGTTTCAGCCGAGTGCACGTACGTGCCTAGAATGATCACTTCGCGGTTGATCACGA
GTTTCGCGCGGTCCTCACGCACCTGCACCACACAAAGCCCCGTCAGCACAGCGGCGATCAATGTCCAGCCCCGAGCCGCCCCCGCACCCGTCCGCTCTTG
TCCTTGCGCTTCTGCCAGTGCCACCCATCCTTCTTGTAGTCCGAGACCTCCAGCGTATTGTAGAACAGCAGTGTGCCACCTATTGACGCATCGCCGACAG
CAGCAAGACGTAAGTGCGTCTGTGCAGCAGATAAAAGCAGCGCACGACCGCGCGACGTGAGACCTACTTGGCGGCCGCAGCTGCAGCGAGCGGAGCACCG
GCACGCCCACGAGTTTGTAGTGCAGCAGCAGGAACACCAGCTCGTCCTTCACGAGCCACCGCCGAGCCGCTTCCGTGCGCAGAGAGGCTGCGCGCGCTTG
GATGCCATCGCCCGAGCTCATTCGCCAGTCCGCCTCGTAACGTCGTCTGTTTGGCTTCAAGAGGACGCGGGATGCAGTACCGTAATGTCTGTATTATTGT
CCTCTTCCCGCAGTGTCGCAGATTGCCGTGAACAGGGCACCCACTGGCGGGTAGTCATCAAACTGAAGTTTGGATTCGTCTACTACAACATGTTGCTGTA
AGTATCTGCAAAAGCGGTATCTCCTGCTACTTGGAGCCATTTTGGAGCTGCGGCTCTAGGTGGTAGACGCGGCCGGGGGCCACGCCGCCGAAGTGCGCCA
TCTGCGCCGCCGTGCGCTGCTTCTTGCTGCGCATCTTCATCGTGTGCCAGGCCACGCGCTCGGGGTCCTTGAAATCGGCCACCTGCCAGACGACTCCGGG
TACTCGGATGAGCTTCGCCCTGGCGGGTGCGGCTGGAGAGTTGCTGAAGAGCTGCTGGTACATGGAGATGGTCGACACCTCCTCGTCTCCGCCGGCGGGC
CCGACGCCTTCCACCTCCAGGCGCAACGCGTCGCCCATGAGCGCAAAGCCGATCTTGGTCAGTTGCTGCAGGTTCCACAGCGCCAGCGTGTTCCACGGAG
ACGTCAACCCGCTCAGCTCCAGCGGCTGTACCGCCGGGTCGGGCTGGAAGGTGTGACCGGGAAGTGCCGTGCCCACGACAAGATCATGCGCCGGGTCGAA
GTTCGAGCGTAGCAACGCCACGCCAGCCGCGTCGACCTCGATCTCTAAAGACTGCAGCAACAACGTGTCAGCCTCCGGAAAGTGATCTGCCGCGGTGCCT
ACCAGGGCATTCAGCGCGGGCACGAACTTCCCCCAGTAGAGCATCTGGATGATCTCCACTTTGCCAGCAATCGCCCCGGAGGCCACTTCGCTTTGCAGCT
TTGTCATGAACTCTCGCACCGAATCAACGAATACGCTTGTAGCCTTGGAAGAAGTGGGCGAGATCGAGTCTACGCCGCTCGAAGAAAACGCTGGCTTCGC
TCCTGTGATCGCAGCAGCAATCGCGGCTGGGAGCCCCACAGCGATGAGGATGCCGCCATCCGCGTACGTCGCTGCCCGGGCGCAAAACTCGCGTAGTTGC
TGCAGCAACTTGTCCACGTCGATCCGCTCGTACTGCGTATGGCTCTGCCAGTGTAGCCTCGTGCCCACCACCGTCGTACCTCCCATGGCGGCCCCGCCGT
CTTGCGCTCGAGCAGTGCTGCTGGGAACTGGAAGCGTTTCCACGTCACATCGCGGTATCAGATTCAGAAACGGACCGCGACAACGACGCCGCGGTGATCA
CCTCGAGTTCGCTCGGGTCGAGAAGGAAGGTGTCATTAGGAGCTTTAGATGCTCTATCGCGCTTACTGGCTGGCTGAAGCTACGCGCCCTACCCTTCAAT
ACTGGCAGCTTCAAGCCTCCAAGTGATACACGCGACCGGGCGCAACGCCGCCGAAATGGGCGAGCTGTGCGGCAGCGCGTTGCTGCTTGCTCGCCATCTT
CTTCTTGTGCCACGCGAGACGCTCGGGGTCTTCAATTCCGTCCACTTGCCACGCGATGCTGGGCACTCGCACTAGCTTCGCGGTCGTAGGTGACGTGCTG
TTTGCGTAGAGTTGCTGGTACATGGCGATGGTGGCGACCTCCTCGATGCCCGCCGCAGAGCTAATTCCATCGACCTCGACCCGCAATGCGTCCCCCATAA
GTGCAAACCCCACCTTCGTGAGCTGCTCCAGGTTCCACAGCGCCAGCGTGTTCCACGGCGATGTCAAGCCGCTCAACTCGACCGGTTGGCTGGCCGAATC
CGGTTGAAACTCGTGTCCAGGCAGAGCCGCACCCGCCACTAGATCGCGCTTGAGGTCAAAGTGGGAGCGCAGCAACGCCACGCTAGCTGCATCCACATCG
ATCTCCAGAGACTGGAGCAGGAGCGTGTCGGCTTCCGGGAAGTGATCGGCTGCCGTACCAATCAATGCGTTCAGGGCAGGCACGAACTTCCCCCAGTGCA
GCATCGGAATGATCTCAACGTTGCCAGCCAGGCTCCCTGCATCCACCTCACTCTGCAGTCGCGCCATGAAGTCGCGCACGGAGTCGATGAAGGCATTCGG
CTCAGGGTTGGCTCCATCCGACGAACGCGCGGCAGTGAAAGAGCCTGCAAATGCTGCTGGGAGCCCCACCGCGATCAGGATGCCACCGTCGGAGTACGTA
GCGGCGCGCGTGCAGAACGCCCGCACCTGCCCCAGAACCTTGTCGACGTCGATGCGCTCTCGCTGCGAGTGGCTGTGCCAGTGCAGCCGCGTGCCCACAA
CCGTCTTGCCCCCCATTCGTGCGTTTTGTCTGCAATTAATTGCAATGGGATTCTGATTCCTGCATCTGAGGATCCGCTTCAACTTCCAAGTAAGATGGGT
CAGCACAGGTGGAATTCCACCGTGAAGTTCAAGCGCGCGTACGCCTCAGCACACGACAAACAGCGCTACTGACTCATGGTAGACCTTATTGCTATGGCAC
ATGCACGTCAAACTCGAAAGCTTTTGTATTTGTGGATTTGATAGCAATCTGCAAAGGAGATAGTGCTCGCAGTGCGTCGTGCATGCGCGACGAAGGCCCA
TCAAGGCTAATAGTACTCACGACGAGGCGGCGGGGGTCCGTATCCGTATCCCGGGGGTGGCGGGGGCGGGGGGCCATACCCAGGAGGTGGCGGGGGCGGG
TATTCCTGCTGCACGATGACAGGCTGGACGTACACTTCTCTTTCCCTGGGCGAATGCGAATCATGTCGGCGTCTGTCGTTGTTGTCTGCCGCCGAAGCAC
CGGCAAGACAGCACGAAGCGCAGCACAGGCCGGCCAAACACCCGCAGCACTCGTCTCCGCAGCAAATATCACAGCCGGGGCCGTCGTCAGGTCCGCACAT
GGTGGTCTCCAGTCACTCTTGCTCTCTCGACCCGCTTTCTCTCTCCTCTTCGGTCGCTTGTGGTTGACCTCGGACTTGCTGTTGTGCTGGAAATTCTCGC
AATGAGGTCATGTGCAGTGGTGCGAGCGATCTCCAGAATTCCGCAGCTTCATTTGCATCACATGCGACGTGTGCACACTCGGAAGTGTATGTCGGTGGTG
TCTCACGAGCCACAGCAAAAACGCGCCGAAGCAGTTGATGCTCGAGCAATTTACCCACGCCAACCGTATCATAATCGCGGCAGGCAGAGAAAACGATCGG
TATCAGTGCGCAGGGCGTGCATGCCCAGCGCCCCGTCCGCTAGCAAATTGCCAGTGTGGCAATGCCATGTATTCAATGCGATGTGTAGTATTCATTATTC
GCGTTGAACTGGTTCCTTCCTCGACTTCGTAGCCATCTCCAAAGTCTCCAATTCAAGCACGCTACCAAACCGTATTCGGCCTCATAGTCGTTGCTTAAGT
CCACCCATACATAAGTGTACTGTATCAGTTCGTGGCGCGCACTTGGGGCTGCGGCGGGCGGATTTGGGACATCACCACGGGCTGGACAGTCACGTCTCGG
GAGTTGTCGTAGTCCCTGCGGCGAGGATCGTCAGCGGCGAGACGTCGACGGTTGTTATCGTTCGCGGAGGCAGCGTCGCCGGCGAAGCACGTCGCGCAGC
AGGAGCGAGCGAAGCATGAGCTGGCGCCGTCGGGCATCGTTTTCTCAATGAGCTGAGAGACCTTCTTCGGAAGTGGGTCTGGTCTGTGAGGGAAAAAGCT
GATGCCAGCTGGGGATTCGACCAAAAAACGCAGGCAGATCGGCAGCTGACACTTTGAAGTTGACGCCGGTATTTCAAACCGTGGACTTATGGACGCGGGC
CCGGTGTATGCTAAAGAGATATTGCTAAAAAAGATAGCGCTGTTATACCCAACTACAAGCTCTCCTCCACACATCTCGCTCAGTCCTTGCGGCCATTCTG
CTCGAGGAACGTCTTCATCGCCTCCATCACCGTGGCAGTCAGCGCCTGGCGGTCCTTCTCGCGCTCCTCACGCTCTACCTCGAGCTCCCGCTCTCGCCGC
TCCGCCTCCAGACGG