Description :
From Genome Similarity Track
Location :
scaffold_185:11516- 32499
Transcript NameFunction/comments
Pl_108081hypothetical protein PHYSODRAFT_516871

Sequence
20983 bases(100 bases per row)
CACTGCCTCGTTGCTCATCGACGGGAGCTATCGACTCACTGGGCTGCTTCTCTGTGTCTTCACCATTCACTGGCGATGCAATTACTGCTTCCAGCTTAGT
TGTCGTTTCTCGAGGCGTTGTTGTCTGCTTACTGGACAAGTTCTTCAGTGCTCGTTTCGCGGGAGATCCCGAAGTCTTTGGCCTCGAAGTTGCATCCGCT
CTAGCAGTTGTACCGCCATCTTCAGCTCCATCTCGCTGGCGCTTCTCCAACTGGACACGCTCCTGGTGCTTTTTCTTCAAGACAGATTCGAGTGCGCGCT
TCTTGGGCGATAGCCTGCGGTTTTGCCAGAAGACGTACGTGCCAGAAGGTGTCGAGCTTTCAGCAACTGCGTTTTCTTCCTCATCAGGCAGCAAGTCTTC
ATTCACTTCATCAATCGACGCGGGTCTTGTACTCTTACGCTGTACCAGCGTCGGCAGCTTTCCGCCAACCTTACGCATTAGTTTGTGAGCAAGGGATTCA
CGCCTGTCACGCAATTCACGAAGCAGATTTTGCCGTTTAACCAGTAATTCTGCCCGTGGATCAGCACGAGGGCCGAATCGATCGGATGAGCTCACGAGCT
GCTCCTTGATAGCTTTTTTCGTTGCTGGTTGGTCTACCTCGGTAGCTTGTGTCTGGAGCTGTTGGTGATACATGCGGACGCAGTGCATGCCGTACAGGAA
ATGCTCAAAGTCCACAAGATCGGCGTACGCTGAGTCGAATGCTTCAAGTAGCTCACGGACTTTTGGTGCCGGGACGTGAACTCCAAGATCATATACAGCC
TGCGCGATTGCTGTATGTGACACCAAACCAAGCTGAGCTGCATCCGCTGCTGCAAACAACAACCTGAAAGCTTCGACCTCCTCTTCACTGAAGTTATTGA
GTGTTTTGCGCAGGGTTTCGCGCCTCTCGATTGCCCGTAAACGATGCTGTTCCTGTTTGAAAGTCCGGAGTTGACGGAGATAACGTGCGCGAGTAACTCG
TGTAAGCAGACGACGTTGGATTCGTACGGCTGCCGCGTAGCGCAGTCGATCGTACAATGTAAGTGACCTGTCCAATTGCTCGCGCTCTAGTACTTTCGCG
TCTTGCGGACCAATTCGCAACAAGGCACGACCACGTCGGATGATCCTCGCAGCTAGCGTGCGAGACCACCAGTCACGGAGTGTACGAGCCACTATCGACG
CGAAGATCATAAGGGGCTCCACCACCAGCTCCTGAATCGCTACACCCACTGCCCAAGCGAGAACGCAGCGCCAAGAAGTGATCAAACCAAGTTCCATCGC
ACTAATTGCTATCGCGTACGCCATGATCACTAGCCACACGAGGCATATTGCAAACACGACGTATACTATTGATGCCGGGTATGGAACGTCGTCTGCACTA
GCATCGCCATTCAATTCTACGACGTTGTCTTCTTTGTCATCATCTGCCGCAAGACTGGAGATCAGCACGTGTTCATGCTTCAGTGGCGCTACCGCGAGCT
CACTAGCTACCGAAGGTGCGACACTGTCCAAACTCGAAGCCAGAAGTTGCGAGCGCAGTTTTCCACGAGCAGGAGCAGCAATTTTCAGGCCGACAACAGT
CTCGAACGTCTCGCGTACGTCTCTCTTTACGTCATCTTCGTTAGCTCCAGAGTCCGGTACACGCAACTTGAGTTTAGCATCCTTGGAAATGACCAATTCG
CGTGCGAGGAATAGTGAAGTGACAGTCATCACGAACAGGAGTCCTGCTGCAGTCAAAGCGCAATACGTCGCCACGTCCGCACCAGTGTGAAATCGAGCAA
GCATACCAGCACGACAACCCGGTAAGGTGGTGTATTCCTGCTTCGTTTCAGTCACGACTGTGCCGCTGACACTTAATGCTTCGTAAGTGACTTCAATAGG
GTCACCTTCGGGGCAGGGCAGGAATGGCGCATCGGTAGCACTCCAAAACCCACAGCAATGCATTTCCTGCTGCACGGTGTCTTTGACATATCCTGTGAGT
TCTTCCTTCCATGCTGTCTCAAGACGCTCAACGACACTGAAGCCTGTGGTGCGTACACTCCAGCTATTCAAGGCATTGGCGTCGTCCTGCACCACTTCGT
GAACCATGAAGACAACTAATAGTACGGCTCCAAGTGCTAGTACAGCAGCAATCGCCACTACGACCAAAGCTACAATTGCAGGTGTCGCTTTTCGACGGTG
GGATCGCTTCATGTGCTGATCCCGGAGATCATTAGCCAGCGCCGCGATCAATGCAACGATGATAAGTGCACCTGCAACAGCAAGCAACTCGAAAACGTCT
TCATCAAGCGGTACTCCATAGAGCGAATTATTATATCCAAGTCGAAGAAGTCCGAGTAGTGTCGCGAGTGCACAACCTCCCAGGAACAGGATTATTCCAC
ACGTTTGGAATGCCCAGGCCACAAACCGTGTAAGCCAAACAAACCAGCGTTCTTCAGTTGTGGCTTGAGTCGCTTCAAGCGTAGATGTATCGCCGGCGAC
AACCGATTGTTCAATACCTTTGGAAGTCTCCTGAATGTCTGGTCGACGTCGTCGAAACCATGGTGATCTAAATAGCAGCACCTTCTCCTTTCGCTGGCGA
GCTGTGGTAACTTCTTTAGTCTCATCGTCTGCCCGGTGTCGTACATGCTCGAACAAAGCAATAGTGCACGTTTGTACTGCGAGCCCCACGATTCCGCCGT
AGACTAGACCAAGTCCGAGTAACTTCCCCACACCTGGTTGCTCGCACGATTTTAAGGACGTCCGATAACATCCTTCTGTCGCGAAGTATCCTGCGTACAC
TGCAAGCGATGCCGCCCACGCACAAAGGATACTAACAGTACGCTGGGTTCGTGTGAGGCGAGCATCAAACCTTACGCCGACTGAAACCAATACGTGATAC
CGCCGAAAATCGCGACGAAAGCTACCTGTCACGTAGCGAAGTCTGCTCTCAAGAGCAAACCAGGCCTCTGCTTCGTAGTTTCGGACGTCACGTAAGAGGA
AGGCACCCAACACAAGAGCTATAATTTCCATGAGTGCAAGCGCCAAGAGGAATGCAAACAACCACGCAAACGAGGATTCAACTCCTGTCATAAGTGGGCC
CTTGCAACCACGTGAAATTGCAAGCGAGCAACTAGGATAACCAAGTGCAGGACGGTCAAACACGACACCTTTGTGTGCTCTAAGCATGGGGTCGTTGAAA
CCACAGCAGGAAAATTCAAGCGCTATCGTGTTTTGCGTCGAAGGCGTTAACAAGCTCCACTGATCATCTAGAAAGTCTGCGAGTTGTGCATGCCAGCTTT
CATCTGACAACGATGAGTAGTGTGAAAGGTGAGCTGTAAGTCCTACTGCAGCAAATAGCGCCATGGCGAGTATGAACCGTGCTACACACTGCAAGAATAG
TTGATGCACACTGAATTGAAGAGCACCACGGGTCGAGTACGCAAAAATGAATAGAGCGAGCACCCCATAAGCCATCAGTGACGCGCCCATGGATCGAGCA
AACACCATTTGGAATGCACTCGAGCTGAAGAGCGTCCAACCTGCAGCAACATCCAAGCCGATGATGAAACACGAAAACGCAGTCAAACCTGCTGCCAAAA
CCACGAGAAGAAATGCCAATCGTTCAATGCTAAGCCGCCAACCAGGATGCCACTTTCTCCCACATTGTTCACTGTAATGTAAACCACTGGCAAAGAGCAG
AGCTGCAACACTAAAACCAGCCAGTCCACTGCATAATTGCCAGGCGATTCCAGCTACACGGGAAACATACTGCTTCATTGGCGTAGCACATCCATTTAGC
GCGTCCGTGGGGCATTTGGTGTCGCTATTCACAAGTGTTGATTCCGCTTTGGTTTCTGTAAGCATGCGAGTCTTCTGGACGTTTAAGTCGCTTCGCGAGC
TATACACTTGATAAGTGGACGTTGAAGTGAGGCGTCTCCATCCTCGAGTCTTCTGGACGTTTAAGTTGCTTCGCGAGCTATACACTTGATAAATGGACGT
TGAAGTGAGGCGTCTCCATCCGAATTCTTCAGCTTGAAGCGTGTACGTCACTGTGCCGTTATCAGCTTCAATGCGCTCGTAACCACAGCATTGAAACGTG
TTCTGCACGAACAATTTCGTATTGGACGAAGCTGAACTCCATTGATCTTTCATCCGCGTATCAATTGCTGCTGCTTTGGAACTGGTCTCGGCGTTATCCA
TAAGAGAAAACTGGGAAGAAAGCTTATGCCCCACACCGGCCAACACGAATGCAGCAACGAAGAACACGACACATGCCAAGAAGTAGCAAACCATTAGCCA
CTTCGTCACATTTTTGCTTTTTGTGGTGCCAAGAGAGCCAAGCCATGCTACGATACCACCAAGCAAAGCAAATATCTCCATCACACCTCCAGAAATGAGC
AAGTACACGCCTAGACGACGGTCAAACACACGGAGCAGATACGACACTTGCAGCACGTTGAGCTCGAAGAGTACATCAATTCCTAGACACAAAATTCCAA
CCCCAGAAGCTGCAGCTACCAAGCTCAAAAACACCAGTCCAATTGCGCAAAGCCTTTGAGACAGTGTCGCTGGTTCACGAGGTTTTGAAGTCTCTTGGTC
AGATCGAATTGCAGCCAGGTTAGAGTACCGGCGTAAACGGAAACACAACCAAGCAGATAGAACGAGTACGATAGCCTGAGCTATTACAAACCCTGTGAGA
CGATCGGTTGCTAGAGATAAAGCACGTTCCAAGGCACTCTCCACCTGAACACGACAAGTAGGAACATCAATATCTGATGCACCTTCAACGCAAGTTCCTT
GAGAGTTGATACTAAAGCCACAACACTCCAAATTCATCTCGAGTTTCAATGTCATCGAGCGCGATAGTGCCGCGTACTTTGCCTCGATCGCTTTAGAGAT
CGACGGATCCAGATACAAGTCGGCATGTAGCCGTCCAATATACACACATACTACCAGCGTGATCAGTACGAAGATCATCGAAAAAACGATGACCCAACGG
AGAGTTCTCATATCTCGTCTTCCCAACGCACGCAATGCCGACAATGAGAGAACCAAGTACACAACTGCTCCAGCCATGAGAAATGCTCCAACCTCAACAC
CAAATAGCGCAGACACGAGTGGATCAGCCATTGCACCCCAATGCACCATTAAATCAGCCCCAAAAATTACTCCACCGACAGCAGCACAAGTTAGCAATAC
GAAAAGCGGGGGTAACGAGCACAATAGTGCAGCTGATATCATTGAGCGAACGATAGTCGCCTCAGCTGCAACACTCGTAGCAAGTTGTACCAGTCGAATT
CGGCGCCACCGAACGAGAAAATTTGCCAACGCAATACAAGCGATCTCCACGAAGAGCACAATCTTCACGTAGGTGAACGAACTGGTAAACAATGATGTTG
CCTGTTTGCCTAGAATGACTGAACATGTTCGAGGAGGAACAGCATCTAAGGCTTCTTCTGGACAAGATGATTCTTCGCTGATGTCCAGGAACCCACAACA
TCCATAGGAAGCCTGGAGTTGAATTTTCGCATCGGAAGATAGAGCGTCCCATTTCGATCGGAGTCCAAGAGCTACAGCACGTGGCATGGTGTCAAAGTTC
TCTAACAGGTGAAATGTAAATATCACAACCAGGAATTGAGCGAGCAATGCGAGACTTAATGACGTCAAGTATGCTGCTCGAGCTGTGTTTGATGCTTCTC
GTTGTGCAAGAGCAACACCGGTGATCCCACCTGCCAGCAAAACTGCACCACCTACCGTAAGTGTGATTCCTAATGGCCCGCCATACAAATACAGCACGAG
TTCTGCTGGAGTTCGTCCAAGCACAAATTGTACTTCGATTCCAGCAAACAGCAGGACGATACCTAGCAGTGCCAATGCCAAATTGCTAACTCGGAAGAGC
AGTGTCACACGTCGATATTGTCGATCTACGAGGTTCGAAGACCCAAACAAGGTACGCGCTTCGTTGGGTAGCTGGACATTGGTATCTAATGGTTCATCGA
GTGGTTCCTGCATTGAAATGCCGTTCACACGTAACCCACGCACGGACGATGTGAACGCTGCAGAGGACTCACCAACATCCGTGGTCGCTGTTGGTGCTTC
GGAAGGGCGAGATTCCAGTCTTTTCTTCTTCTGAGCGACGTAGTAAGCGTCAAAGTCCTCGAACACGTTAATAATCTGTGTTCGGGCTTCCAACTCGCCC
CACTTTGCACGATTGAGTCTCTTGATGGTTGTGACCTTCTCGCGTTGCAAGTCACGTGCATCTAGTTGCTGACCGACTTTTGCTACGATCACGAACACAC
CAACAAGAACAGCGAGAGTGACGCTGACAACGAGAGAAGGTTGGTCGTTCCGGTATAATTCCGGATGCAACGCGTAGAAGTCTAAACGCTCTTCCAGAGT
GACAAGAACTTCAAGAGCCGACTCGATCTCTGTGCAGTAGCAAACTGTAAACTCTTTTGTGCTAGCGCTTTCATCATTGAAGCACATATCCACAGACCAA
CTAGAAGACTCCGCATCCCACGAGTGACAGACTGTAGAGAAATTTTTCTGCTCAATTGCTGTCAATTCACGTTCGTGCGGTATGGTGAGACCAACTAGCG
GTACCCATTTCTCCATCTCGGTATCATCTGTAAGTCGCCGCATCGACTCGGACGCGGTTCTGACACAAGCACTTGAACTCGTAAGTGTCTGCATGGTAAC
ACCAGCATCGGAAGAGTACGTCGTCACTGTTGCAGCCTTATTGATGGCAACTTGAGAGTGCACGGAAAATACTGTTAACCGAGAAATTGGTTCGGATTCG
TTGAGAGTACAGGCCGGATGTGGACTCTTACCGAACGACAAGACATCCAGGTAGAGATTTGAGTCGAGACACACCACTGCAGAAGGAGTGAGAGTCATCG
CCATATTATCCGAAGTCGTGAAGCTCACACCTTTTGAAGAATACGTTCGTATATCACTAACTTCCAGAACAGTCGGTGGTTCATCAACGAGAAACTCGTT
ACTACTAAGCGCTGCAAGGGATTGAAGTGTGCGAACCACATTATTCCAGTTCGCTTGCTCCCCAATGGTAATGGTTGTGTCTGAACACGAAATATTGTCC
GAACTGGTCTCTGCTAGTCGACGGGAGATCCAGCCGCTAGAACTACCAAGATTTAGCAGAACCGAGATCACTTCCAGCAACGTATCACTTGTCGAATCCA
AGAATTCATCAGGAGTGTCTAGTGTGAGTGAACTACCGGCGATACCGCTGCTGAGCTCTGTTACAAGACCAATTTCGTCTTCGCTCAACACTTGAGGCGC
GCCTCGCATGACTGAGCCGAGTACACGAGCTTGTAGACCAAGTGCTGAACTACTAGCTTCCACTGAGCCAACTGCGCTCGAGACTGTCGCTAGGATATAA
CTATGAATTGTCTGCACATCAACAATTTCCGTAGCGCAATTATCGCCCATGAATCCTTCTGGACAACTAGCAAGACGTCGAGATGATGAAGACCCAAAAG
CTTTTTCCAAAACCATAGCAGCCGCTAGAACCTGACGTACATCGTCTGATGATTCACCATTCGACTTCACTGTGCCATTAGCATCAAACATACCCGCCGC
ATATTTTGTAGGTGACAGTTTGGCTGCTTCAGGTAACAACACCTCAATTGTATCGTAAGCAAGTGCCACCGCACCAAGACGGTCGGTAATAAATGCCAGA
ATTGTCACGTTTTCGCTGTCGTCCATGTCTGCAGAAGGAAGCATTTTCGCACTGGCTGAAGGTGTGAGTTGACTCGCTACCAAAGGCGTCATCGACTTCC
GAAGCTGTGCCACCAAAGTATTGGAATCCGTCGCATTATTCTTCACCACCTCGAAGTTTTCAGCAGAAATGACTCCAAACGAATACGTTAGAGGATAGTC
ATCCACATCGTCGCTCCACAACGAGCAAGTAAGAGTAAAGACATCCGTCATCGCGTATCCTGATTGTGGGCTCACAGCAAAAGTACCAGAAGTTGGCGGT
GAATTCACAACTACGGAGAGAGAGCCGAAACCTGTGTTACCCCCTGTGTCCGTGGCGATAAGACGGAAATTGTACGTGAGTCCCGACGTTAATTTGAAGC
TACGAATTGCATTGTTCGCACTTGTCAGCGGTAGCGTGAACGCGTCACTTGTGTTGCTTACGTCTGCACTAGGAAGCACGAGATCTCCTAATGTTTGTGT
CCATCGCGTAGTATAAGGATACTCCGATGTCACAGTTCCAGTAAGAGTCAAACGACTAGAAGGATTAATCTTTGTGGCGGATGCAGCAACCAGGACGACC
GGAAGACGTCCAACTACGGTCCAGATTGTGGTAGATGCTGTTGCATTGCGAGTTCCTTTCGAAGCAGTTAACGAAAACATGAGTTGGCTGCTTGAGACGA
GATTGAATGGTGCAATTCTAAGCACAGGGGCGGAGCTCAAAATTAAAGGAACGGAAGGCGTGACAGAAGCGTTCATACATGTCTTCACAACTGAGCCGGT
GGAATTTGTCACGTCTTGACATGTCCATGTGTAGGAGAACGGAGTACTGGAAAATTCTGGATCGAGTGTTCCAGATCCATCAAGGACAAGAGTATCTCGA
TCACCAAGAGCACAATCTCCACCTTTAATGGAGACTTGTGGCAAACTACCAGAGACTATCACCGCGATAGATGCAAAGCTGCTCGATGACTGATTTGCCG
ATGCCCCCTTCATGTAGGCTTCAGCTTGAAAAGTGTATGTTAAACCAACTTGTAGCGACGAACGTGGGAATCGGAAAATACGAGGGTCTCGGGCGGAATT
GTCCTTGCTGAAATCTACAGAGGCTACCGCGCCTGTGCCATCGCTGTTTTTACTGGTTGTTGTCCACCGGTACGCGACATCAGAACTTGACAAAGTTGGG
CAACTAACCACTGCATCAACCTGCAGCACTACGGGAGCACCAACTCTTGTCACTATCTGCGTAGAATCACCAACGATAAACACTGCTGGTCCTGGCAAAC
TTTGCACGTTGACAGCTTTTGAAACTACTGTGCTTAGAGAAAAAGCATTCACTAGGTTTAAGCCGACACGATACCCGGTACCCGGTTCTAGAAGAGAACC
ATTCACTTGGAGCAGTAGAAGACCTGATGCTGTAGCATTTTGCGTAGCAGATCGAAGATAGCAAGCGGAGCGAAGTTGTGCCATGGTGGAAAGAGTCGAA
AAATCTGACGCAGCGCTGGTGTTAGCAGCCGAAGCTAGAGTAATATCAGCAGTGGGAATTACTGAAACACTCGAAATTCCTGTAGTCCAGTCCGTCCTGT
ACTTTTGACAAAGTAGTGCAAGACCTGCATCAAGTCTCTGGTACAACGCGAACCCTGCATCAGCACTAGTTTGGGAGACTGAGCTTGAAAAAAGTGAAGC
AGGAAGTGCGAACCACGTGAGCTGTGCAAATGGCCGACCACCCGATCCACTCGAGAGCGATGCATCCGCAGACCAAATTCCACAACTACCAGTATTTTCA
GGAACTACTAGCACAGCATTAGGTTGAACGATATTGGCTGGAACGCTCACTGCAATGCTAGCTTGAGAGAAGGAACGACTCGAAGGACGTGCTCGAAGCA
CATCAGTAGCATTGCAGTATTGATCAGCATAGGATTTACAGTCATTTAAGACCAATTTGTCACCAGTCGACACAGTCGCTCCAGCACTAAGCTCCATTCG
CAAATTTTTCCCATCGACCCACAAGCAGTAAGCTTGGGAACCGAGTGTGTATTTTGCAGCAGCCAAGTTGAATACCAGACTGCAAGAAAAAGTCTTAAGG
TTAGTGATGTAAGTTCCTGAGGTAGTAGTCACATTCATGGAGGCTGCGTGGTAAACTGTCGAGTCGAAAGCGATGTTAATTTTTGAGCCTGAGCTGTCAA
ATATGGCGGTCACCGGTAGTGGTGGCGCAATCGACTCTCTGTCGTTAATCATCACGGAAACATTCACAATACCAATGGAACTGTTAGAGATATTGTAGCC
CACATCAGCACTTGAGACAGAGTGAAGCACTGTCGAATATTGTGTGGCAGCTTCAGGAATTTCATCATCGATGGCAAATACTGTCACAACGCGAGGAACA
GACCAATCCAACGGAGTGAAGACCAATTGAACGCTACGAATGGTTTCCGTTCCCACTAAAGTCATCCCTGACGATGAAAACGAACCGAATGACGTTCCAA
CCTGAGGTTGCGTAAAAATCTTCGAGTCCGTTAGGCTTATGATTTTCTCAATGGCAGGGCGTAAAGTTACTGTCACGTATTGGTAGGGTTCCGAGTTCAG
GAAAACGCTGTAGGAATCATTGAAACTGCCTTCAGCAACATGTAGTTGGTTGGTCGCGCTTTGAATCGATATGTTCACGAAAGACACATCGTTGTCAGTG
ATGTAGAGCGTGACATCGCCTCCACGTGACCCATAGTCGCTAATAGCGTAAAGTGGATCAGAACTTAATGAAGCATGAGAGATTCGAGCCGCGTGTACAT
TTGCTTCGTCAAGCCGGTCATCTACTGCAATGAGAGACACGTTTTGCCATACACTCCAGTTGGTAGCGCCGAAATACAACATGGTTGATCCACTCACGAG
ACTAGCATTGCATACACGCTGAGCTGTTTGCACACGTTGATAACAATTGTTACTGGCGTTTGGCTGAATGACTACAGGTGACCACGGCTCTGAAGTGAGA
CGAATGCTGTACGAGAGCACAGTAGTGTTGCTTTCTATCGCATTTAACACCCGTGTCGACAATTCAATCCCCGAGACATCATTATCAGTGATAAAAACCT
TCACCGCGGTCAGATTTCGTAACCCAGCATAGATGAGATCGTTCGTTGTTAGCGAATGGTTGAGTGTACTTGAGGAGCCTATTACGTCTTGAGTTCGGTC
ATCAAATGCTGTCACGTTTACAGTTTGCGTTGTATTCCAATTGCGCCACGTGAAAACCAGCTTTGTGGGGTTTGGTACGGCAAAATTCCCCACTGTGCCA
ACGTTGGTGACGGATACAGTCACCTTCGCGAACGGTTCTGTGGCTAACATGACAGTATATGAATCTACAGCACCTAGGCCCTCCGTCACGTATACGCTAG
TCTTGCTGACAATAAATCCTGACACATCGTTGTCGTGCACAGTAACGTTAATCTTAGGGATCGTAGGAATTGCATTGTACTTCGGGTCATCACTATACGA
AACGTGCGAAATTCCAGTCATGTGGGTGTCATATTCGTCGAGGTAGTCGTCTGTAGCGAGCACCGCCACTTTCTGTGGTATATTCCAGTTTCGCGGCGTG
AATAGGAACTCGCTTACTGGAAGTGTGACGTTGCATAGCCACAAGCGATAACACTGTGTATTGCTATTATCAAGCCAGGGGAGAACAACAATTTTCACAT
CAGCTAGCGGCTCAGAGTTTAGCTGTAAAAAATACTGAGCAACGAGTACACCATCCTCGCCCACTTCCAGTGCCGACTCAGACACAAGAACCTTCGCAAT
ATCATCGCTCTCCACTTTGATAGTCACGTTCGGTAGAGGATGTGCCAAATAAATGTAGTCATCACTGAAAACGGTATGCGTGACTTTGGAAAATGTCACG
TTGCTGTTTTCTTGGGTAAATTCATCGAGGTAGTCGTCAACAGCCTCGAGTTTGACTTGCTGTGGAATGCACCAGTTCTCTGGAGTGAACACTATCCACG
GGTTTAGCACTGTGTAGTTACAAAGGAAACGTTCTTGAGCCGTCTCATTCGCGATAGCGTACACACAAAAGCCTTGAAGACCAAGTGGATCAGTCAGGTC
GGGCTTGAACAGTGCCGTAGGAATAACCGAACATCTTGGTTTTCCTAGTAGATCAAATTCTGATGGAACGGGCAGAGGTTCTATCTCCTGCGTCACGAAG
GATACATCCAACGTGATTTTCAGGTCAGCAAAGCGCATATAGTCCTCTAGAGCCCACTCTAATCTCCATGTATGCCCTCCATCCAGATATGGTCCTTCAC
GATACACACGCACACCTTTGTCGAACTTGATCCCGCGCCAAATTTTCGTCTCCGGGTCATACTCTGCCTCACGATTTGAGCGTACGAAATGTAATGCTTC
CAATGCTTCATCCATTCCGATTGCACTCACGTTGACAGGCAACCGCCAAGTCGTTCCAACGTACTTTTGCTTGGTATCTGGATCAAGCAGTTCAAGTCGC
AATGTGAAGCTTCCACCCAAATATGTGCCATTAGCAATGGTAGTAGAGGTTAAAGTCACACCAGGAGCTTGTAGCATGACATTGTCTGCAAAAACTGCAA
TTGGTGGGAGATTTCCAGGACTGCTAGTGTAGCTAATTGTCCACGTGTATCCGTTGCAGACGTCGAAGATATCGCACTCGACTCCAGTGCGTGAAACATT
CGTTAATTCAGTGATATTCAACGAGAACAGCACCTTACGAAGCTTCCTAGCCGTTGTATTAAAAGCCAACGATGTGGTATTTTGCGATGGCAGATTTACC
ATATAGGCGCGACTTGTACGCGGATCTGTCTTCTTGAACCAACCTCCCATTTGAACAGTAAAATTTCCTCGCAGAGGTTCTCCATCTCGTACAGTGCTAA
CCCCTACGGTGACACCTTTGCCTGTCAGATTTAGAGATGTTACGATCATACTAGGTAAATTCCCGTAATTCTCGAGAAATTGAATAGTCCACGCCATTCC
TCCCTCTGCAGACAATTTTTGGCGTGCCACAGTCACATTTGCTATGCCCTGAAGCTGTACTAACTTGGTTGCAAGTGTGTCAGCAGAATCATTCCAGAAA
ATCGGCACAGTGCGGTTGGGCTTCGTAAAGGTAGTGATGTTGAGTGGGGTGAAGTAATCAATAACAAAAGCCCCACCGATCACTACTGGAGACTGCGTCT
CATTCACAGTAATCGCCACTTGGGCCGTCGAACCCACAGAAGCATTGACACTAGCCGTAGAATTGACTACCAAACTCGAAAATGTATCCACGCTGACAAA
AGTGATGATGTACTCGAATCCGTAGCCTCCATTAGTCAAAAGCCTTCGTAGTACTGACACAGTATACATTCCTGGCTGTGAAGTTAGTGTACTTTGAAGA
GCAGCAGCCGTTGGTAACATCGGAACTGAGAATGTAGCTGTTCCGTAGCTTAATTTGAATGTTCCTGTAGGACTACTACTCGCTCTCGTGCGTTGACACG
TCAACACTCCTTGAATCGCTCCATTTGTCGCGATAGATACGAGTGGAAAGGTACCATCCGAACTAATAAACCTTAGGAATGTGATACTCCATGTCAGAGT
TGATGCAGCATATTGAATATCTCGTGTCACAGAGACAGCATTTGTTCCACCAGGAAACAAACCATTGACCGCTGTTTGGAGTTGCAGAGCTGTAGAAAAT
AAATCAAGAGCAGGTGTACTGGATCCTGCTCCATTTGAGATGATAAATGTACTTCCATAACTCGCACTAGCGATGATACTATCACCAGACGGGAAGCTTG
TCTTGAACGCGTCATTAAACGTGAAAACGATCGACTGAACCTCCAAACCGAATCCTCCAGATAGTACAAGCTGAACAATTTGATCAACGTGATTCGCATA
GGTCACAATTCGCTGTACTTCAGTGACCTTGGTCATGCGTAAAGAGATTTGATGGATCTCACGAGTCGAATTTGAGCGCAACTGTACCAGACTCACGCTT
TGCTGTCGAGGTAGTCCACACGAAGTCATGTCGAATGGAAAACCACATCGTCGATAGCACGCTTTGTTGGCCTCATTACTCATCGCAATTGTCACGTTTG
CATACGGCTCGGTCAACAATTGAAGAGTATAGAAATCTGCGTGTGGGTATTTGAGTATGGAGGCTGATAAATTCTTCTCTGACAAAGGAACGAGTGTGGT
GGAATATGCTAACTCCGTATTATCGTTGTCTGCTATGGCCACAACAATTTCTGGTAGAACGAGGTGGTTGTAAACGGGATCCAAACTTTCTGAAGTCGAG
CGGATAATTGTTAAATGCACGTCTTCTTCATCAAGATGATCATCGACTGCAAGAACTCTTACTGTCTTGGGCAAACTCCAATCACTCGCTGTAAAAACTA
GAATATCGGGGGAGATTGTGATGTTGCACAACAACGTACTGGTATTCATACTTTCCGTGTCGTCTCCACAGTTCAAGAAGGAGTTGTCTGATGATACAGC
AAATTTCCCATTCGAAAGCTTAACGGTTTGAGAAGGACACAACGGATTCATTTTACAACGACGATAACAGTCAGAAGCGATGTGGAGAGTTACGCGAACT
TCTTCTGTTGGCTCTGACAGCAGCACAACCTGGTAATCATTTGCTTTTCCGTCTTCTGACACACTCAAAGACGCGGTTGAGAACTCGATACCCGGTACAG
TCAAATCCATGATTGTCGCCACTACAGGCGAGATAGTGATGGGATCAGCATATGCATTAGCAGCGACAACAACTTCTTGTACAAGTTGCTTGGTCCAGTT
CACGTGAATATTCACTAGAGCGTCTTGTCTTGCTAATTGATCGCTAATTCCGAGGACTTTGTTGAATACTAAATCACGGTAGAACGCAGTCACAGACTCA
TTGATGCCCTTGAGAAGCTGTTCACCTCCTGTTGCACTATTCACGCTAAATGTACTAGCTTTCGAGGTGAGTTGATATGATGGTGGGCTGAAAGCCACAT
GAAATATATCTGAGTAGTGTAAACCTTCGTAAAGCTGATCATCTGTAGCTAAAACGTGTACAAGCTGCGGCAAATTCCAGTTCTCACTCGTGAATACAAG
AATTGTTGGTATAGCAGACACGTTGCAAAGGTTAAAGCGGTAACAAGCGTTCTCCGCATTGAGCTTTACAGTAACAGGTTGCGGTGGTTTGGCTGACAAC
TGGATAGAGTAAGTGTTATGAGCTGCTGTCGCTTCCGTTGATACTCCGTCGAGAAAATCGTGATAATGATCCAAGATTTCCGTCGTCGCTAATGCTCGAA
CAAACCAAGAAACACTAGCAATTAATCCCACAAAACCACCAGCAACAGAATCCCGAGATCCAAACCGAAGGACCTTTTGCGTGAAGCTCAGCACTGCCAT
ATTGCACAGCGTTGAGTTCGTGTAGCAGTTAGCCATCTGAAACGTACCCGAAACACAAATGGAGAGATAAATACTGGACGAAGTGGGGTCATAAGTTGCT
ACAACTTGGTGCCAGGTCTCTGGAAGTGGCAACACATTTGCGTCCTCGCCGAGATCGGATCTACATGTCATTCCATCAGCTGGGTTAATCATCTCAAAGT
AGAACCGTCTAGTTTTACTGCTGATCCCCACAGTACCAAACGTGACTTGATTGCCATGTGCATCCATCCCGTACATATTGACAACATCAGCGGCGAAGTT
GTCTCCTGCAACATCGATAAATTCCTTGCGAAAGTCAAACCAAAATTCGAGTGAAAATGAGCTCATAGCTGGTTGAACAGCGATCGCAGCAGAGAAGAAC
GTGCCTTCCAAGTTATCATCAATATTCAAATCCACTGAAGCCGAAGTAGTTTGCAAGACCAATGCGCCAGTAGCTCGGCTATTTCCTCCCCACGATGCTC
CACCTTCGTCATTGTTAACAAGGACTTTAGCGGCATTGTCAAATGGCCAGATAGCTACTGGGTTGTCACGCAGCAGCAAAGCGCGATTCTCATTCACAGA
CAACGGAAGTCGATCAACAGGCAACAGCTCCGATTTTCCTAGAACTGCGATATCAACGAAATCACTGAAAATTAAACTTTGTCCAGCTGCATTCTTGGCG
CGCAGGGGTGTTTGACATGCTTTGTCTCCACAAACGTAAGATTTGCACTGCGAAGATGGAGCAACAATTGCACCCGTTGCATTCAACTCGCACACGGTTG
ATGAACCCTCAGCAGCCAGAGCTTCAGATGCTGTATCACTGCGAATTTTGTTAAGTACTGAGCCATGCGAAGCAACAGAGAATTCAGTCACAGACTCCAC
ATTTGCAGATGAACACTGACTCACATCGGTATTGACGTCGACAAGACCAATTTCCACAGGAACTTTAAACTCCAGAACTACCCATTCATGATACGAAGGT
CCACTTGCCATATAACACAATGTATTATCCTTCGCATTTAATAATGCGTTTGCTGATCCCGCACCTGTGCTCGCAAGTTGTGAACTCACGCTGTGAATTT
TGTAACTCAACGGAGTTGCCACGGTTAGCGTTGTTGAGTCTGTAGCAACCACATCACTTGATGGAAAGACTTGTATGCTAGCAACTGCAAGTGGTTTCTC
TCCTGTACCAAACAGATCCAGCAAAAGATAGCGGGACATCGTGGCTGGATTCCAACGCAAAACTTCCACTTCATTCAGCATCAACACGCCAAGACCACGT
TTCCTCACAGTCACAAACCGAGCTGTCGAGAACGCATTATCCCACGAAATCGTGTTGGTATAGTTGGTACACGAAAATGACAGTGTTGTGCTGGTAGTGA
TGGAGGCCCCAGACGCAGTGACGTCACTATTCATTAAAGGTTGATCCGACAGAAGCACGTCGAATTGCTGAGCAAAAGGAGCTGTTAGCTGTAACAGTGA
ATCATATCGACTATAATCGTACAGATCACCACTCCACGCTGGATATGTTGCTGGGATTGGTGCACAGAGTTCATCGTAATGACTCCCAACGTAAGGATAC
AACACCACAGAGCGAACAGGTTTCACACTCCCCAGATCTACTTCCCACCATGAATCTGTTCCGACATCAGTTCTTGTACTTCCCGAGATCATCATACTAT
TTGTTTCATTCTGGACAACGAGAGGGTCCCAGTTGGTATGTTTTAACCCGTCCACAGCTAAATAAGACAACGCACTACTGGGGTTGGTAGTGCTTTGTCT
GGTAACCATTCCAACTGCTAGATTTTCATTCTCGGATCTCCTTACAGTCTGCAGAATGTGCCATGACTGTAACAATGCGGGACTTGGTGCCCAATCCGAT
TTCAATCGAGAACGGATCCCAGTTCCATCCGCCGTTGGTGACAATGACAAGAACGAGGCAAACGCCTGTACTTGTGCTAATTGCAATGCTCCGGTACCCT
CACGATAGATACGTACAGCAACGGCACCAGCTTGGACTTCCCAGAGTAGAATCCCCTTTTGAACCGGTAAACGCTCTACTTTGGGGCAAGCACTTGGACA
ACCATACACAAGAGCATCTGTGAGCGATAACGTTTTGGAATCGAACACCTTCAGTGAAGCAACAACCACGATGTTGAATGCGTCTGACGTTGAAAATGTT
TTGACAGCAGAGGCTGGCACAAAAATCGCTAACGTCCCTAACTTAGTTAATTGAGGGAGCGTCACTTCCCACCACGGTTCCTTTTCACTTGTAGTCGTAG
CAACATCAACAGTGCTGTTGATCGAATCATCATATTTTGCTCCGTTGGTGGCAAGTGACGCTACCAGTGGTGTCGTGGTTACTGGAGAAACTGCAGTTGA
ACTTTGTGTAGCTGCTAACCCACTCAAAATATTTGGAAACTGGTAAGATAGCGACAACAGCGGACGCAATTTCCTCTCGAATACGGATGAACACAATTGT
GTTGTAGCTACTGATACAGTACTCCCTCCTTCCGATAGTACTTCGATCTTTAAAGACACAACAGATAGTCGTGTGGGGAGTAGTTGCTTCAGAAGTGGGG
AAATATCCACCTCAATGGAACGGCTTTTCTCCACTGTTGCTGTGATCTCCACAGATGCTCCATTCGTCACAAAAGAAAGAGGTTGAGGCGTAGTTTTTCC
ACTACGAATGCTTTCTGTTGTCCACGCGTTGTCTACCACAGTCACCTTAAGTGTATATTCCTTTGTAAAACTCACTTCATTTGTTGAGGACGTGTCAGTC
CCTGTCGACACATTAAAAATCTTGTACGGAGTTTGATGAAGCACAAGCGTTGCACCCGAGTACGTGAGCAATGTGTCGCCATCGTGTAGGCGTGGTAGAT
GAAACTTCATGAACGTTGTCATATTGGCACCCAGCACGAGGATATTCCCAAGAGATGCCTCATTTGTTTGACCATTTGTCACAGTTAAGTCGTGGAAGGC
TAGTGCTGTCACGTAGTCTCCGACCCAAGCAATAGTATCACTTGCTTCTTTTGTAGCAAGTTTGCCTTTAGGCTGATTGACCACCACATCGACTTTGGCA
ACGTCATTATCTCGAACAAAAATGTTTAAGCGACTGTAATCAGGTGAGTGGAGAACTGTTGGCAGTAGATTGTACGGAATTGCGCTTCCGCCCACAATAT
CCCAGTTCGTAGCGGGTGCGATCGTACCTTGGAACCAAAACGCCGTTGAGTTCGTGTATCCGTAAGGTGAATTTTGAACACGGTGCGAAATTGTGTAGCT
TACGTTGAGTTCCGCCACAGCATCATCCACCGCACGTACAACAACAAGCTGGGGAACGAACCAGTTTGTTGCTGTAAAAGTTAAGAGCGAAGGAGTAATC
GACAACTGAGAATTCCCTACGATCGCAATGCTTACATTTGGTGCACTAACACCGCCTTGAGAGTTCCATGCAGTCTGATCATAAATCTTCGCAGCCAACG
TTGAGAAGTCATTTCCCCAAAATCCACACAGATCCGATTGCTTGTCTGTACAATAAACCGAAGAGATCTGCTTATCTGTTGCTTTGATAATCTTTGCTTG
ACCCCCAATGGATGGTGGAGCGTTCAAAACAACATCGTACGTGGTGCCTGTTTTATCACCTTCACTCACTTCCAGCGCTGCAGTAGAAAGCGTGATCCCA
GGGTCATTATCCCAAATACTCACGTCGATGCTGTTATCTCGAAGAAACTTCGCCATACCACAATTCCACGAATGTCTTTCAAGCGAATAACTCTGTGGAA
ACATCGCAAAGATGGCATTAAGTACGCGATCTACGTAACCTGACGGCCATTCTTCGAATGCCCAACGCATCGTCTCGAGTCGTACCAAGCCTGCACAGGT
CGTATGTTGAACATTTTTCGGGTTCGTACTCATTTTACGCGCTTGCTCGACATTCATCAATCCGAGAAAACTCAGTACAAAGCTTCGTAACTCAGATGGC
GGTGGAGAAAACTCCAATTCCGGATCTGCTAAATCGCCAGACAAACTTGTAAGGTTAGAATCATTTTTCTGTGCTGTTAACATGGCAATCAGAGTCACAT
AGCTCATGTCAACCGCAGATTTATCCGTGTTCCCAGGGTCTAACGACGGGTTTCCAAACCTCGCTGGAATTTTTCCACTCTTGTTGATCACATTGGAAAC
ACAGGCACCATTGCCTTGTCCAAACGCACATTCGTTGGTTATATCACAAACCCGCACAGTAGTTTGACCGGCTTGTAGCTCTGCATTGGATAGTAAACAT
ACTGACGAGTCCAGCGGGTCACAATTCGGTACGTCGAAACATTGTGGACGACGAGTATGGTATCGAATATCCTTGCTCACGCTGTAGTGGAGCAGAGAAC
CTCCGCTGTAAAGTCCACCGTGTTCAACCTCAGACACGACATCCTCAACAGCACTCACCACCACACGCTGAGAGATATTCCAAGTTTTTGGTTGAAAAAT
GATCTCTGCAGTTCCAGTTCGAGTTGGAGTGTTCAGAACTTCAGATGCTACCGCTGTTTGGTTCGCATGCAACGGCATGACCACAATCTTCACGGGATGC
CATGGCCGCGACTTTAGCACGATATCGTAACTATCATTTCCACCACCTTCAGCAACAAACATGTGCTGTCTCGAAAGTGATACCCCTGCAAGGTCATTAT
CATCGATCTGCACGGTAATATTGCGTCCAGCGAGAAAAGGAGTCTCATCGCCATCAAAATTCGGGTCTGTACTAAGCACAGTGTGCGTCACAACGGCATA
ATGTCTTCCTTCGGCTAAATCATCGTCTACTGCTGTTAATCGTATAAACTGTTCTTGGTTCCAGTTTGCGGGTGTGAAAACTACGCGCTGCGACGTCAAG
AATTGAAGCTGCTGGACAGGTTCCCCGCTTGGATCTAGCAGTCGTACGTCTTCAGCTTTTACTATGACATCCGCTAGTGGCTGTCGGTTTAATACCACCG
CATACTCTGCAACTAATCCTCCTTCTCTGATACGTCTCCTTCGCGGAGTTAATGTTACTCCTCCATCCATGGCATAGTCCAAAATGTCTCCACCAAAATT
CAGACTCACTGCAAAATCATACTCCGCTTGGTGTGCGCTGCTTCTCGGTTTCGGGTCCATGATCTGTGCTTCATAGTCAAAAAGTATGCCGGCATGTGTT
CTGGTCTCTAAAATCTGCGCTACATCCACTTCCACAGTCTGATCCACTTGGTTCGTAATGCAACCACCCGACAGCAAAAGTGTATTGAAATTGCCGTCTA
ACGACACTCCATAAGCAAAATCGTTCGCGGTCGTACCGAACTGCACGTGAAAAACAATAAATACAAACGTTCATGAACAAACAACACCATGGAAGCTAAA
AAAATGGAAATACCTGACGCAGCCAGAGTTTGTCTCCGTTTAGCGAGATTTTAATCAGCACAACATCTCGACCACCGTATCGACCGAATCCGTTGAGTGC
GTGACCTCCTTCATCGAGATAACCCCATGTATACCCTGCTACGTAGAGAAATTCCGTGGTTGTACCGGTTACTGCATCCGTCTCATTAATGATCGTGATG
GATGTCGCTGCGTCCGCTTGGTCCGTCCCCCACTGAAAGAAACAACCAAGAAGTTAATGCTCTCATCTGGTAGAATGTCTGTTTGAAAATCACCTCTCTG
GACCAGCCTATTGATCCGTTCGCGTTGATACTCGCGACAAAAATGTTGAGTACATCAACGTTCGCGACGTCAAGAGTCTTGGAACCTGCAAAGTACAAAT
TCCCGTCTGCGTCCTGCACTCCGTTTCCAGCAATTTGAACAATTGCGTTTGTCTCGTTTTGCTCCCAGTCGAAGTTTTCGCTC