Description :
From Genome Similarity Track
Location :
Scaffold_36:1151563- 1154816
Transcript NameFunction/comments
Phyin_T30-4PITG_1472930S ribosomal protein S16%2C putative
Phyin_T30-4PITG_14730Nucleolar protein%2C putative

Sequence
3253 bases(100 bases per row)
GACGAACATGGTGGTGAGACTGCGCCTGGCCCGCTGGGGACGTAAGGATCTGCCTTTCTACCGCATCGTGGCGGCAGACGCTCGTGCTCCGCGCGATGGC
AAGCACCTGGAGATCGTACGTTTGGGTTGCGTCATCTTTCGCTATTATTCATTCATTTACCACAAAAAGCAGCAAAGTTTCTGACAATTGCAACTTGCCA
CTTTAAACAGCTTGGGACGTTCAACCCAATTGCTGCTGGCGATGGTGTGAAGGAACTTCGTGTGAACAGTCAGCGTGTGCGCTACTGGATGTCAGTGGGT
GCACAGCCTTCCGACCGTGTGGCACACCTTCTGGGTCTTGCTAACGTGCTGCCCATGCCGCCTACTCGTCAGTACACCAAGAAGAATGTGCCCAAGAAGG
ACCGCGAGTAGACACCAGCACAGGATAAAGGCAGCTTAAGTGTAGGGAGTAGACGGAGATACATATTTTTCACATGAAATCTTGCTCTCATGTTGGCCAA
ATGTTGGCCTCTTGATAATTGCCATGACAATCACTCTGACGCAACTGATTAGACAGTGAAAATGCAACTTTTCTATTGGAAATGCAAATGCAACAGTGGT
GCAGCCTACTTCCTGGGGGTACGCGCTCGAGGAGCAGGTCCACGAGCGGAGCCTCCGCCCTTGAGCATGTTGCCGCCCTTGCGCACTTGCTGGTTGAACG
TGGCGTTCTGTTCCTCAAGCCAGCGACGGATCTCCTTCTGTTTCTCCTCCTTGGCAGCCAGACGCGCCTCTTCTTCCTTTTGCTTCTCGCGGTGGATAAA
CTCAGCGTCACGACGAAGTTCACGCGCAGCTCCCTTGCGGGCACGTTTGACTTGGCGTTGCAGCTGCTTAAGTTGCGCAGTGTCCTTCGGCGCCGTCTTG
TCCTTACGCACCGTGTAATTCTCATCAAAGTGTGGCGCAAACGTCGGCAACGTCGAAGGTGCAAAACTCTGCAGTCGGAGCGGGCGACGAGCGTCCCAGC
AAGCCTCGAGACGAGTATGAAGCTTGGAGATCACAGCGTTGACCTCCGATACTTTATTGTTCTCCAGTTGCTTCACAATTGCATGCAACAACAGGTAGAG
CGGGTAGAAAAGCTCGTCAAAGGACGGCAACGACGCGTACTGAGCCGACGCAGCGTCCAGTAGAGCCAGTAGAGCGCTCAACACTTGAACACCGTTGCAA
GACGAGCTTCCAGCCAATGACAGACGTGGTAGAGCAGGCATCTTGCCCTCCTTTTGAGCTGCTACCCACTCCAACAAGTCGCGACGTAGCCAGTGCGTTG
AGTTCTCGTCACTTGACGTCACAAAGGCACGTAGAATACGCGTCAGGAAGCTCACGACTTCAGGCATGAAGCGTTCCTTACCGCGTGTCATATCCAGAGA
CAACGACGCCGTAAACAGCGCTTGCGTAGCCTCTTGTGGCGAAGTGACAGAGCCACGAGCCAAGCTCTCGCCCAGTAACGTCTCCATAGGAGACACCACG
TTGTGTCGTAAGTCCGACGTGGGGAAAACTGACGTTAGGGCCTTGAACAGAAGCAACTCCGGTAGTGTGGGCCACGCAGACGTCGACGCACGCTTGTGCA
GCCGCTTAAAGAGCTGAGCTAGCAGCTCCCGCACCACAATACCCGCCGTATCGCCCATCTGTTGAGCCAAAGTGTACATGTTCTTGGCTAGCGCGTCCAA
CTGCAAATGATACGGTTAAAAATTACAAAAAAAAGCAACCACGCAAAGTATTGACGTACATCGTGCTTGTGTCCGGCGTATCGCGCCGCGAAGATGAGGA
GCTGACGCACTAGGACGGCGAAGAAGCGCTTCATCTTGTTCTTGTTCTCCACACTAAGGCGCGGGTTGTAGTACGTCACGATACGCTCCAAGATAAGGCC
TCGCTTCTCAGGAGAGTTACGTGCGTGTTGCTTAAACAGCGACGCCAGCTCTTCAGGAGATTCGGGACATTCAAACACGAACGGAAGCTCAGCAGCAGCC
TCCTCGGCGTCCTGTTGGCGCTTCAGTTTGTCCGATTCGTCGTCACTGTCCTCGTCCTTGTCTTCTTCCGGTTCTTCTTCTTTCTTCTCTTCCTTGTCAT
CATCTGATTCCGCCTCAGAATCAGATTCTGATTCCTCGTCACTCTCCTCTTCGTCGTTGTCTTCCTCTTCAGCCTCTTCAGCGGCAAAACGCTCATCCAC
GGCGTAGCCATCTGTGAGATCGTCATCGGTAGGCGGCATCATGATCAGCTGCGGGGTCTTTTTCTTGCTCTTCTTGCCTTTCTTCCGCTTCCCGTCACTG
TCACTGTCACTCTCTTCATCTGCGCCATTCATACGCGCCACACGCTTCTTTTCCAGCTCTGCCAGTCGATCGCGCTCCTTTGCAGCAGCTTCTTCCGGCG
ACATGCGACGCTCCGTGGCCTTGGCTTTAGCCTCAAAGGCAAACTCTCGCGTGAGCTTGTCAAAGTCATCCATGGGCTCTTTCGGCAACAATTCCTTGCC
ATTCGCACGTGTGGGACGGAATTCCAGCAGCCCACGGACATCTGCGAAGCCCTCGTCCAATTTATCGGTCGCATCCTCCTGCGAGCTCTTGTTCTTCTGA
CGCTCCGCCTTGTACAGTTTGGCCTTCATCATCACCTCATGCATCACCTCTTTATGCGTCTTTCTCTTGCCATCTCCCTCGTCGTTATCTCCTTTGCCAC
CTCCGAAGTGGAGCTGGTTGACGATGTCTCTGTCCATCTTCCTGCCTTCCGCTGAGTCGTCCTCGTCGTCTAATGGGCCGTCGGCATTGAGCTGGTCATA
GTCGTCGTCGGTGATCTTGGCGCCTTTATGCGTTAGAAACAGCGCGTCGTCGTCATCTTGCTCCGAGTCGGAGTCGTGTAGCGCAAAGGCGGACGCGTTG
CGCAGCTTGCGCTTGCGTTCGGTCTGGAAACGTGCCATCATTTTGTCCTCCATGGACAATGTGGGGTCCTGTTCGCCCAGACGCTTGTCTTTGAACACGT
TGCTCTTGTTACGAGCATTAAACTCGGCACCTAGTGTCTTACGGCGCTTACGCTCGGCCTCGGCGCGTGCTGCTGCTACATTACGGCCTGCGCCTTTGAC
GCGACGTCCGATAACCTCGTGCTTTTGCTTGCTGGCATTGCCACGCACGTCGAATGGATTGCTGCCTTTGGAGCTGCTGGCGCGCACGAAGCCGTGCTTC
TGCTTCTTGACAGAGACCTTCTTGCCGCCGCCTTTCTTGAACGCCATGGCTGC