Description :
From Genome Similarity Track
Location :
contig_77:115133- 120193
Transcript NameFunction/comments
g12491.t1hypothetical protein
g12492.t1XP_009846822.1 hypothetical protein H257_19374 [Aphanomyces astaci
g12493.t1POM64563.1 Integrase catalytic core protein [Phytophthora palmivora var. palmivora

Sequence
5060 bases(100 bases per row)
GTTTCAGCAAACGCCACAAACTCCGCGAACTTGGCAGCCACCTCGGACTTGTTCCTCAGCAAGTACACGACGCAGAAGTGCGACTTGTCGTCGATGAACG
TGACGAAGTAGCGCTTGCCCCCAAACGTTGGCGTCTGCATGGGGCCGCACACATCGCTGTGAACCACCTCCAGCACGTGCTTCGCACGGTTCGGGGACGA
CTTCATGTAGCTCACTCGCGTTTGCTTGCCGAGTGCACACCCGTCGCACAGCTCCCACTGCTTCACCGACGTCATGTCGATGCCAACACCGTAGCTCTTC
TTGACGATGGCGTCTAGACCGCCATGGCCAATGTGACCAAGTCGGAGGTGCCAGAGGTACGACGTGGTGTCCCCTTGGCGATCCTTCGAACTTGCCGCAT
TGGCCTCGTCAGGCATCATCGGAGTCATGCACAGCTTGAACAGCCCTTTGCCCTCACGAGCGCCGAGCTGCCACTTGAGACCCTTGTTGTCCGCGAAGCA
CCCGTCGCTCTCGAAGGTCACTGGCCCGACGTCCTTGGTGAAGCGGCCGACCGAAAACAGGTTGCGCGACAGCTTCGGGATATGCCACACATTCGTGAGC
ACACCCTTCTTCATGCCGCGCGGCGTCTTCATCGACATGACAATGTCGCCGGTCCCCACCGCCTGAACCACACCGTCGTCCGCGAGATGCACGTCCACCG
GAGCCATCTTCTTGTAGTTCCTCATGTACTTGGAACTCGTCATGTGCTGCGTCGCACCCGAGTCGACCAGCCACATGTCACTCGGCTTGGCAGTACTGCT
CGTACGACCAACCGAGAAAAGGTAGTCGCCAGGATCTTCTTCGTCCTGCGCGACGTTCGCACGCTGCGACCGATATCGCTCAGCGTCGTTTGGACCCGCG
AGGACACTCCGCGATCCAATGTCCTTGTTTGCCGCAGTTGTGGCACGCCCCGGTCTTCTTCACCGGTCGGCCCTTGCGCTTGTTGTCTCTCGTCATGAAC
GCTTGACCTTGGCCGTGCGCGGCTCCGTCGACGCCGCCACAAAAGGCTTTGGTCGGTTGATGGCAAAATGCAAAGTGATTGATTTAGGTCCTTAGTTCGC
AAACTCCCTTGCTACCTCTAAGCCTACTGGATTCTCTACTGGATACACTCTACTGGATTCCTTACCGGATACTGAGTTGCTTCAGCCAGTCAGCGACTGC
CACGTGGATGCCCATCTTGTACCCACAATCTTGTACCCACGTGTCCCGTAATCCCCGTAGCGTAAACAGCGTCCCATCATCAGTGTCCCGCGTCCCATCA
TCAGCGTCCCGTCAACACAGGAATGATTGCGGTCCCACTAAGTGAAGGTCATACCGGTATCCTACCGGTATACGGCAGCTGCCCGAGGCGCCTTCTTGAC
AACAAGCAGCAACGACGAGCTGTTGGAATTGACCAAGCACGCGTTGAGCAAGCGGTTTGAGATGACGGACCTCGGCGAGCTGGAGTATTTCCTCGGGATG
GAGATCAAGAACGACCACGGCTCCGGAAAAGTGACGGTGCGGCAGACCAAGTTTCTCAAGTCCATCCTGACCAAGTTCGGCATGCAAGACAGCAAGCCTG
TGAAGACGCCGCAAGACCCCGGACTCAAGCTGACCAAGAACATGTGTGAGGGTGGCTGCCAGCATGAAGACATGATGAAGAACGTGCCGTATCGGAGTGC
CGTCGGTGCTCTCGTGTACTTGATGGTGGCAACGCGTCCGGACCTCGCTGCTGCAGTGGGAGTGCTGAGCCAGTTCTCTGCCGACCCGTGTCCGACGCAT
TGGCAAGCCCTCAAGCGTGTGCTGCGGTACCTCCAAGCGACGCCTACGCATGGACTCGAGTTCTCACGGGAAGACAGCCTTGGTATGTGCGGATATTCGG
ATGCGGACTGGGCCGGCGACATCGAGTCAAGACGGAGCACAAGCGGCTACGCGTTCATGATGAACGGCGGATGCATCAGCTGGAGGAGCAAGAAGCAGCG
GACGGTGCGCTGTCTTCAACGGAGGCAGAGTACATGGCGCTATCGGAGGCAACACAAGAGGCAGTGTGGCTCAAGGTGTTCCTGTGCGAGCTCGGCGAGA
TGGCAAGCGATGAAGCGGTCAAGATCTACGAGGACAACCAAGGCTCCATCGCGTTGGCCAAGAACCCGCAGTTCCACAAGCGCACCAAGCACATCGACAT
TCGCTACCACTTCGTGCGCGAGAAGATGGAAGACGGTCAAGTGGTGCTGCAGTATGTTTCGACAACCGACATGCTGGCGGACATGATGACGAAGGCGATC
ACTGCGGTGCAGTTCAGTGTGCTTCGGACCAAGCTCGGGATCCAAGGTGCAATCGCTGTCGAGTCGAGTGGGAGTGTTGTCAAGAAGGCGCCTCGGGCAG
CTGCGGGATACCGGTAGGATACCAGTATGACCTTCACTCAGTGGGACCGCAATCATTCCTGTGTTGACGGGACACTGATGATGGGACGCGGGACACTGAT
GATGGGACGCGGGACACTGATGATGGGACGCTGTTTACGCTACGGGGATTACGGGACACGTGGGTACAAGATTGTGGGTACAAGATGGGATCCACGTGGC
AGTCGCTGATTGGCTGAAGCAACTCAGTATCCGGTAAGGAATCCAGTAGAGTGTATCCAGTAGAGAATCCAGTAGGCTTAGAGGTAGCAAGGGAGTTTGC
GAACTAAGGACCTAAATCAATCACTTTGCATTTTGCCATCAAGCGACCAAGCCTTTTTTGACTGCCTGGAATTGGTGAAGGCCATCTACGGTCTCAAGCA
AGCTTCGCGCGTGTGGAACGAGACCTATGACGAGTTCATGTGCTCTATCAGTTTCCAAGTGTCGGCCTTCGATCCGTGCCTCTACATCAAGGTGGTGGAC
GGTCAGTGCGTGCTCGTGCTGGTGTACGTGGACGACGTGCTGATTACCGGGAGTTCACACGAGCTGATCGCACGGACGAAGACGGACCTGAAGACGCGCT
TCGAGATGACCGACAGCGGCAAGTGCGCGTTTGTTCTTGGGATCGAGCTGGTGGACGGCCCGGACGGCAGCGTGACCATGTGCCAGCGTCGCTACGTGGA
CGACATCCTGAAACGCTTCGCCATGGACGAGTGCAAGGCTGTGGTGAGTCCGGTGGACATGAGCACTCGACTGGTTCCAAGCGACGCGGCGACCAAGGTG
AACGCTCCGTTTCGCGAAGCTGTTGGTGCGCTGATGCACCTGATGACCGCCACGCGCCGGACATCGCGTACGCCGTTGGCTATGTGTCGCGCTTCATGGA
GAACCCCAAGAGGAACACTGGGTTGCGGTCAAGCGCATCTTTCGCTACCTGCAAGGCACCAAGACGCATGGCATCTGCTTCAAGCTGGGCGACAAATCGA
CTTTCGTGGCTACTCGGACGCGGACTGGGCCGGCGACCTCGCGGACCGCAAGTCCACTTCAGGCTACGCGTTCATGCTGATGAGTGCGCCTGTGAGCTGG
GGAAGCAAGAACAGTCAAGCGTGTCGCTGTCCACGAGCGAAGCGGAGTACATCGCGCTCAGTCTGGCTATCCAAGAAGGCAGTGGATCCAAGTGGATCCA
TCGCCTGCTGTGCGAGATTCTGGCGGCTGCCAACGAGACGGGACCCGAGCTCATGATCCGCGAAGACAACCAGTCGTGCATCAAGATGACCAAGAACCCG
GTGAACCACGGCCGCGCCAAGCACATCGACATCAAGTACCACCACATCCGCGACGAAGTGAAACGCGGTGAAGTGAAGCTCGAGTATTGCGAGACTTCTG
TGATGCTGGCGGACATCATGACCAAGGCACTTGCGGGACCACGCCACACGGAGCTGACGGCGGCTCTCGGCATTCATGGGACTTCGCATTGAGGGGCGTA
TGAGGTATGGAGGGTTACCGGTTTGGTATCGGTTGTTGGCCGTGAACCGGTTAACCCGAACCGGTCCAATCCGAACCACGCCGATTACGCCACCGACGAT
TACGCCACTGTCGATTACGCCACCTGTGGTACAAGATTGTAGTACAAGATGGGCTTCGACGTGGCGCTCTCTCATTGGCTGAAGTAACCAGTATCCAGTA
AAGAATCAAGTAGTGTGTATCCAGTAGGTCTAGAGTAGCGAGAAGGCTAGCGAGCTAAAGACCTCAATCAATCACTTTCGAATCTTCGTTCTACCCCTCA
AGTGGTTTCCAGTCTCCGCTCCGGTTTCGCCCAGAGTGCTGCCCTCCCTCCGCTCCGTCAAGCTTCACGGTGTCAAGATCCATACCTTCCATCAGTCGCC
CGGCTTGAAGCAGATGCCATGCGTCTTGGTGCCTTGCAGGTAGCGAAAGATGCGCTTGACCGCAACCCAGTGTTCCTCTTGGGGGTTCTCCATGAAGCGC
GACACATAGCCAACGGCGTACGCGATGTCCGGGCGCGTGGCGGTCATCAGGTGCATCAGCGCACCAACAGCTTCGCGAAACGGAGCGTTCACCTTGGTCG
CCGCGTCGCTTGGAACCAGTCGAGTGCTCATGTCCACCGGACTCACCACAGCCTTGCACTCGTCCATGGCGAAGCGCTTCAGGATGTCGTCCACGTAGCG
ACGCTGGCACATGGTCACGCTGCCGTCCGGGCCGTCCACCAGCTCGATCCCAAGAACAAACGCGCACTTGCCGCTGTCGGTCATCTCGAAGCGCGTCTTC
AGGTCCGTCTTCGTGCGCGAGATCAGCTCGGGCGAACTCCCGGTAATCAGCACGTCGTCCACGTACACCAGCACGAGCACGCAGTGACCGTTCACCACCT
TGATGTAGAGGCACGGATCGAAGGCCGACACTTGGAAGCCGATAGAGCACATGAACTCGTCGAAGGTCTCGTTCCACACGCGCGAAGCTTGCTTGAGACC
GTAGATGGCCTTCACCAGTTCGAGGCAGTCAAAGTCACCATCCAGTTCGACGCCTTCGGGAACCACGCAGAACACCACCTCCTTCATGACCCCGTACAGG
AACGCTGTCACGACGTCGAGTTGGTCGAGGGGCCAGCCGAAGTACTTGGCGATCGCGATG