Description :
From Genome Similarity Track
Location :
Scaffold_154:115101- 119094
Transcript NameFunction/comments
Phyci_245273Hypothetical protein

Sequence
3993 bases(100 bases per row)
CAAACCAATGAGTTCACGTAGCGCAGCAGTTCGAGGCGCAGCAAGCACTTTCGTCATGAGATCTGCGCGCATCAGCTTTGACTCGCAGTGCTTCACCGTT
AAAACTTCCTTTTTCGCCAAGACCTTGACAAACTTGTAGCGCACATCGATGTGTTTCGCTTTGCCCGACGTGTCCTACCCCACAATTTGCCGAATTGCTG
CTAGATTATCGACGTGCAACAGCATTGGTTTCTCTACCTTTATGCCAATTTCTTTCAGCACCTCGCAAATCCCTATCATTTCCCCCGTCACGTGGGATGC
CGCCGTGAACTCTGCTTCCATTGTCGACAACGCAACACCTTCCTGCTTCGGCCACTTCCACCTTACCGTCATGCCGTTAACGAGCACGACACCcccgctg
acagacgtgcagtccactcggtcagccgcaaaatcagcgttactaaatccttcaacacgaatgcccttgcttccgttttcacatttggtcatccaaagtt
tcacctctattgtacctttgaggtaacgcgcacctttcttggttaagctccagtcactgcgcgtcggtgcgtgagtttgtcgcgtaactcgatgcacggt
taaactaatgtcggaacgcgtgcagcgcgccacccacaggaggttctccacaggcgactgaaacggcCGGACTGTTGGGTGCTCTTGTGTGCCGTCACAG
CCTGATGGAAGCAGTTCGTCATTGCATCCTACCTGATCAGCTCCGATCGGTACCTTGACGGGGTTCGCATTCACCAATCCTGCCGTCTCCAATATTTCTT
TGATAGTTTGCTCCTACCTTAGAGCCCACTCTTCAGGGATGTGTTCAACGCGGATGCCTAAAACCTTTGACACTACTCCCAAATTTTTGAGTTCAAGAGA
CTTCATCCTATAAAAAAACTTCACCACACGCTCGTTACTGGTTCCTGTCACCAGTAAATCATCGACGTAGACTCCAACCAGTGTGGTGGCTCTGGAGTCa
cacttgtagtaaaggcagttgtcggtgtagcattgcggcgagtatccgagcttcaacagtgtcttgcgtagcagtatattccacaatctacccgcctgct
tcagcctgtcgagactcttcttcatgcgcagcgcggcaccgcggcggtcacgaactccaaggctccgaagcaactcataactaattgcttgtccgtccgg
cacgaacaggtaaatctccacctcctcctctttgcctgcctttacatacgcgtccgggacataaccgtgacgcgctggaacgccccagactgcagccatc
gcgagaacgaccgtgactgtggtcatatctaaaacaccagagaatgccatgatgtaatcgattccatactcctgctcgtttccacacacgaccagtctgc
ccttgcgtcgttcgacgcttccgcatgcatgcagtgttgtcttgtatacccatacttcgtgtgaagAAGCTTCGCACCAACTGGCCTTGCAACAACTTCC
CACGTCTCGTTTCGTTCCAGCGCCCCATTTTTTTCGCGCATGGCCTCCTTCCATTTGCCGGCATCACTACTGCGCATATCCTTTTTGTAGTTCTTGGGAT
CTGATACGATCATATTGACTTCACTTACCGGCACTCGCTTTGTTCCCATAAAGCGCGTACGCATCCGCGTGTCCGTGCTTTCAGCGCTCGGCAACGTCAC
TGCTGTCACTTAATTGCCGGGGTTTCTTACGCCTCTTCCCGCGCCGTGCACGACGACCAGGTGTCTTGATAGTCGTGACCTCTTGCTCTCGCTCCCTCCC
TTCTGCTGAGTTTCGGCCATCACTAGCACTTCTGCATGCAATTCTCGCGGTAGTTGCTCTGTCTGCACCTTACATGCTGCGTGGTGATCACCACGCGATC
CTTAGGCAGGGACACACGATATCCTTTTGTGACATCATCTGTGTCACTAATTCTGCCACCCTGTGCCCGTTCTCGAAGCGCATTCTTCCCAGCATCACGT
CTCACAGTGACTCTCGAACACAACAATGCTCGCAAGACTGGGTCGGTCGCCAGCCAGCATTTCCAGAGGCGACTTGTGCGTCGGGTTTGTAAACGTCGGG
CCCTTGTTGAGGATGTATCCTGCATATTTGACTGCATATCAAGGGTAGGTCCGACTCGacaccgtgccatgttcataatcgttatgtgcatcctttcagc
tttccatttgacgcctggttgttgggcccacttatttgccgagctactccgctttccttgcacaagaggtcaacgtttgcgtattcgcccccactatcgg
tctgcaaggcgtgcacgcgacagttaaagcgcttctcaaaccacaccaAAACCCTTTGAAGAGTCTTGCCGCTTGGTCTTTTGACTTTGTTAGTCCAACT
CAGATGTAATTCGTAAGCCAGTAAacaaagttcacaatgtatctgttgtcattccgatctttgggagtcatcgggcctttgagatcgctacacacaaacc
caccaatgctatcagttgatgcgttcgtgccatcgtgcctgctgtctcgtttagaatgtgcgttcgtggtttgtttgccgcgagcacaagtcaagcgatg
gggccgcgctcgatctgtgagctcagtagatgcgtgactacaactagccatgcgttcaatagcgtcgtagttgaggtgaccgaggcgctgatggaatagc
atcagcgagtccttgaccgcgttgatcacatcacgctcatcagcagccttattgctcagagctgcaaacaccacgtcctgaattgcttctgctctcgtcc
ggatcgtatccacgacgagcacggtgttcctgcagCACCCGTGATGAATACGCACTTCATCGCACTTACGCACTACAAACATGCCATCAGCGCCATCTTC
GATCGTACATCCCTTTTGAATCAACTGACCAAACGAAATAATGTTGCGCGCCAAATGGTCTGAGTAGAACACCTCTGCTAGTGTGATAGTGTGCACCTCG
CAACACACTCTCGTATTGAGAGTCACGCTTCACTTGCGTCTAACTTTCAATGGAGTGCCGTCCGCCCGCGTTAATTCATCATCAACTGCTGCAGCGTTCT
CCAGTATCTTCGGGTCGTGAACTAAGTGCTTACAGGCTTCGCTGTCCAATATCCACATGTTACTTCCACTTCCATCTTCTGTCCGATGCACCGCAAGCAG
AAAGTTCACCTCTTTCTTTTTGCGCCACCTCCTTTGTTCGGATAATTGACCAACTTTTCCACACCTGTAGCACGCTCTTGACTCCGTCGTGTCCTCCACA
CGATTGACAATTCCTTGGCCGTTTCGCTTAGGTGCTGATACATTACGCTCATGCTTCTGCGCGAAGTGGGCGAGTTCTTCAGGCAGTTTGAGGTGGTCCA
TTCGTTGGCCGTTCACTCTTGGCAGCAGTACCGACTTCATTCCGGTGGAGATGATTTTACGAGGTACTCCAGGACGGCGCTGTTTGAGCAATTGCTCGCC
TCGCATACTGCAGTCAGGTATAGACAATGCTCTATCCACGGGCGATCATCCCTTTTTTCTCGCTGTCATCATGTGAATAGCTTGATCGCTCGACACTGGT
GTGTGAAATGCTTCCAGTATGCGATTCATCACGTGCAGTAGTGTTCCTTCTTCCGAGCACCATCGTGAAACCTGCCGATCGAAGTATTCACGTGTTACGG
GCCTCGATATGATTTCCAAGCAGCTCAACTTTGACGTCCTTAGACCTGTCATAGCCCACTGCATGCTGAGTCAGTTCGATCTGCCGAACGAAGCGCTGCC
CCCACTGACAAAACCCGCTTCCGAGTCCTCGATAAGTCTCCTTGCCGCTGAACCTTGCAAGCTGCAGCTTCATCTCCCGTGGGCCAGGTGTCCGTGTTGC
TGGCGTTATCATCCGGTGCATGGGACGGGTCGGTGACATTGGTGGTAGATGAGGACTTGCTGCTTCGTCATGAAGTGGCAATGGTCCCGGCTG