Description :
From Genome Similarity Track
Location :
Scaffold_15:1151- 22875
Transcript NameFunction/comments
Phyta_totarag936hypothetical protein PHYSODRAFT_496419
Phyta_totarag937eukaryotic translation initiation factor 3 subunit, putative
Phyta_totarag938hypothetical protein PHYSODRAFT_492857
Phyta_totarag939hypothetical protein PHYSODRAFT_492063
Phyta_totarag940hypothetical protein PHYSODRAFT_313186
Phyta_totarag941hypothetical protein
Phyta_totarag942hypothetical protein PHYSODRAFT_313188
Phyta_totarag943hypothetical protein
Phyta_totarag944ABC transporter ABCF family

Sequence
21724 bases(100 bases per row)
ATGAACTCGAAGAGTGCGGCGCTGGCAGCGCAGTTGGTGCCGTCCACGTACGTGCAGCAGGGTCTGGATGCAGTTCGCTCGCGTGAGAAGTTGGTaacga
cgctgctggctcaGCGTCGCCTCCCAGACGAAGGTTGGGACGACACCagcgtggagctgctcctgcagacgctctcGGCCAtggacagcaacaacttcCG
GGGTAgcgcaggagctggcgaGCGCGAGGCGCGCGTCTTCTCTCCGCTGGTGGCGCGTCGCCACTTTCACTTGGCACACGGCGTGGGCAGATCAGGCGAC
GTAGCGGCGGTGCAGCCCAAAGCCGCCGGATCGTCGCTCGTGGTACAGGTGACCAACGCGCTGGCGAAGGACGTGCTGCGTCTCGCTGGGATGCGAGCGG
TGCAAGCGGCGTTAGTGCTGCCTGTGGCTACGGGCATGTCTCtcatgctggtgctgctgcatctcaAGGAGTTGAAGCCCAATGCGCGCTACGTGATCTG
GCCTCGGATCGACCAGAAATCCTGCTTCAAGTCCATCTTGGCGGCTGGACTGacgccgctggtgctggcgaaTGTtctggtggaggaggaagatggGAAC
CTTGGTGGATATTTAAAGACGGACTTGGCAGGGATGGCAGCGTTGATGGACCAGTACGGGAGTGACAGTATTCTGGCTGTGTGTagcaccacgagctgct
ttgCGCCGCGGGCGTATGATAGTGTGAAGGAGATCGCTAAGCTTTGTCAGGAGCAGGATATTGGTAAAAAGCTAGCGATGCTTATACGTGCTGCTTGGCA
GGGTGATAGCTGACGAAATATTGTCGCTGTTATTGTTGTTGATAAAGCACACGTGATCAACAACGCGTACGGCGTCCAGGCATCCAAGTGCGTTCACCAA
GTAGAAATGGCTATGCGCACTGGACGTGTGGATGCCGTGGTGCAAAGCCTCGACAAGAATTTCATGGTGCCCGTAGGTGGAGCAATTGTCTGCTCGGCAT
CCCGTGAAATCGTTGACCGCGTGGCAAAATTTTATCCTGGGCGTGCCAGTGCCACCCCCACGCTCGATTTCTTCATCACCATGCTGCAAATGGTTGGTTC
GTTGGCAAGCCGTCTCGTGCACGCTTCTCGGTAACACAGTGGTAACATCCAACTGTGCTCGGTTCGTTTATTACCAGGGGAAATATGGATATCAACGGCT
ACTTGAAGAACGCAAGCACTTGGCAGCTTACATGCgtgagaagctcgaggagttAGCAGCCGAGGAGGGTGAGCGTGTGCTACATGTTTCCAGCAATGAG
GTAGGCATGAACGGCTCCAGTTACGTGGGTTTTGCTTCCGTCCGACTATTTCTCATTGTGCCACCTTGTATGCATAGATCTCCTTCGCGCTGACACTAGC
GACATTCTGTTCGGAAGTCACGGATAGGCAAGAAAAATCGCGACAGCTGACGTTACTTGGTGCTATGCTCTTTTCACGTGGGGTATCTGGCGCACGGTGA
GTTCAAAAACACCATTATGAGAGGAGGAATAATATCAGTCATCTGACTTTCGAGTGCATGCTGCTGACCCAGGGTGGTATCGTGCCTCGACCGCAAGACC
ATTGCTGGGCACGAATTTAACTCCTTTGGAGCGCATCACGACGGGTTCCCCGTAGCCTACGTCACTTTTGCCTGTGCGTTGGGCATGCAGCGTAGCGAGG
TGGACCTGCTAGTCACGAAATTGCGAAGGACAATTAACGAATGGCGAGCGGAAAAAAGCAAGGCACCGGCCACCCATGAACAGGTCCACGCGAATTTCAA
TTAGGCTTGGCACGCGAGAACAACAAGTAGTCGAAGCATAGTGTCTATAAATCTGCTTTCTGACGTGCCATCTTTCTCCTATTGTTTTTTCCTCCTACAG
ACGTAGCAGCCGCACTGGCCATGATTAgtgcttcttgccgccgtTCTTGGACTTCCGGGTTTTCTTTTTGGCCGCAGGCGGTGAGCCAGTGTCTTGATCA
GCCCCGGTCTTGATCTCAAGCTCTCCGAGCAGCTGGTTGGCAATGGCAtcagctgccgctgcggcaTCCACTTCCCGGCGGCCCTTGGCACCCTCCACAG
CCTTCTCCGTGAACTTGGCCATGAACTTGGCTGACTCAATCACACGCGGATCTTCGTCACCGAATGCCTCCTTGAACAGCGAGTAAACCTTCTTCTCGTA
CGCAAGAGCCTCGCGGTAGCCGCCAGCCAGGCTGCATGCCAGAGCCATTTGGTGAAGCGTGTTGGCTGCCTGGTTGCGGTCAAACTCACCTCGGCGAAGA
GACTCGCGGTGGCACATCAGTGCCAGCGAAATCTGCCCCACATCCTGGCACATCATTCCCATCTTGAAGTAGAGCGAGCTAATCTCAGGGAAGTGAGGAC
CGCAGCAGAACTCCAGCAGGTAAATCGCACGGCGGATGTGCGGCACCGCTAGATCCGTTTGGGCGTTCGCGTGCAGGAACAACGCCAAGTTCGCGTGCGC
GTAGGCCGCGTCGTGGTAATCGATACCCTGGAGCTGTATGTACAGAGccagcgctcgctgctgctgcgcgatAGCACCAGCAACGTCGCCAGCGTGGTAG
AGGACAGTAGcgagcgacgagctgcagagaGCTGCGTCCTCGTGGGCTGCACCACACACCTGGAAAAGCAGGGACGACGCCTCCTGAAGGAACTCGTATG
CACTGGACAGGGCACCCTGGGTTAAGTGCAGGCGAccacgctcaagaagctgcttggCCTGCGCCAACGGGTGCGCAGGTAGTGAGGTCTTCACGACAGG
CACAACGCCAGTGATGTCATCCAGGCTGATCGGCGACGATAACGAAAACTCGTAGTTACGGCTCTCCACACGCAGACCCAAACGCTGGCACAGACGTCGC
AGCAAGACCGTCTTGTTCACACGGCCAATAGGGAAGGCGACGTCCTCACCGCCCTCGTCGCTGCCAGGACCCCAAAGAGCCAACTTGTAGTCAAATCGGG
CCTTAATCTCCTTGTCAATGCGCGCCCAAAGTGACGTAGCATCCAATGAAGCAGTTGTAACTGTAGGCTCATCGTTACCGTTAGCCTGCGAGGCATCCGG
CTTGCCCGAAGTTGATCCAAGAATGCCGTTTAGAAGCTTCACAATCGCGGATCCAGGGGCAGCACGGATTGAGTCGTTGGAGTTCAAGATGTCAGCCAAA
ACGTGCTTAGCTACGCGCGAGATCATTTCCACCTCAAGCATCCCGAGCAAATATTTTGAGATACCGCTTatggcctccagcttcttggcaagCGATGCCA
GACGGCCCAGGTAGCGCATGTTAATGCCGCAAGAATGCATCAACTGCGTGAGAGCATAACCATCAGCCGGGGCGATTGCACCACGACGCACGTCAGCCAC
AAAGGCCGGTACAACAATCCTTTGCAGATACTCAGCGGCATCCTTCGCGGCCGCCTCGTCAGCCTCGACCTGCTCCACATCAGATGAAGCTGCATAGTCC
ATGAAGACGTTCGGGTTCAACAGCACCGGAGGAATCTCCTCTTctccctcctcctcttcatgcTCATTTTCCTCCGTTTCCTTTTTCTCGGGTGTAGCGT
CATCCTTCTTTTCGGCGTCAGTCTCAGCACTGTCCTCTTTTTTCTCtttctcttcctccgtcttcttAGCCTCCTTTGCCACCTTGCGAGCCTCACGGTT
GGCGCGGCGGGCTTGATTCTGCTTCCACAGCGAGTACAACTGGATCAGCTCCGGGCGCAGCAGAGCCGCATAACCCTCATCGTTACGCGTGAACCGCAGG
CCGTCTTCCTCAAGTGCAATGGTTTTCTTCTCCTCTGTGTTCTTCAGGAAAGCTTCGCGGTTATTGTAGAATGTCCAATCCTTTGGGGTAATGCGGACGA
GATCCAGGACATAAAGGCGACCGTCAGACCCCTGAATTCCCTTGGCCTCAACCGCACCACAGATGGTTGCCACATTAGTGCTTGCCTCACCACCGCTAAC
AGGTACAACACCAAGGGCCTCTTGCTCCTTCTCAGCAGCcagatcttcttcactcttACCAAACGGCTTGATACTACGCTCCGCGATGTGCAGCTTCGCA
CCTGCCTCGAGCATCAGCGCGTgcattttgttgttggcagcaaTGGTCTTTCCGTGGTCCACAGAGCCGTATACAAGCTTGGAGGCAGCGTCTCCCATAA
GGATACCCGGGATAAGGCTTTGGGCGATAACACGGACACCAAGGTAATCCACGACCGTCGTGGCAAGTGTGTGCAAACCGCGCACATCCGCCTCGTTAAA
TGCCTTCACACCCTGTAGGTCGCGGTTGGCAGCCGAGTAGGCATTCTCCTCACCCCCAGCAGCATCCTTGGTGGACTTGCCGTCGATGGACACTGAGAAG
AAAATGTTGTTGAAAACGTACACGTGAGCGCTCTTGTCGTCCATGGGGTTAATAGGAGGAATGTTTCCTTCAACGATAGCCACCGCGCCCTGCGTCGCAG
CTTCCACGAACTCCGTCACGATCTTGTACATGACACGAGcgcgcacgatctcctccttgaGCGAGTCCATCGGCAACTCGCGGCAGCACTGGTACTCCTC
GTTCCAGTCGCGCAGCACACCACGCTCGTCCATGCCGTACGACGCGCAAAGTTCATCCTCAGCGCGATTGAGGTCGTACGTGTGCTCCTCCGTCGCCGTA
GCAGCAGGCGTGTTCCATGGCAGCTTGCCACCCAGGCTGGAaccagcagccaccatcCACTCGATCGAAGAAGGCCCCTCCTTAGCCAGAGAAGCAGCCT
TGGCGAGGAGTGCAGCGTACGACTCCCTGAACTTCGGTGACACGGTGCTCAGCAGATCCACTAACAGGTGCGCGTGGGCCGCAGCCGTCTTGTGCGGGCG
CGAGTCGAACTTGGTGGCCGTCGAGCGgttcacgaagaagccgtTGACATGCGCCGTGATGTGGTAGCGCGTGTTGTCACCAACGACGACTACCTCCAGG
TAGAGCAGATCGCCTGCCAGCTTGCGTGGTCCTGGGGGCGGGTTGTAGCCCGAAAAGACGATGCTCTTGACGCAGGTAGGGAGCTTGGCGTCCggttgct
gttcctgctccttctgctgaTTGGTTTCGATCTGCTGTTGTTTCTGCTTGTGCTGGTTCTTCTTtcccttcttcttcttctggtcctTGCCCTGGGCAGG
CGTCTCCTTCTGTCccgcctcctcctgcgcAGCGGGGGTAGCACCCGGGAAGGTATAGAACTCGGCGAGGTCAGGCACAACAGGCACCTCGATTCCCTCG
AGCTTGTGGTGGATCTCACGCagacgcttgagctgctgctcggagatctccttgcgcttcttctcgtccagctcctcgcccTCCGTAGGCTCCTCGACCT
tgtcagcagcttccggCTGAGCCTCCGGTTCTATTGCCGACTGGGGAATGGGCGGGTTGCTCTGCACGTCACGGAAGCGGCGCACGTGGGCGCGCACCTT
GCGGGCATCGtacttgtccagcaccatgCGCAGCGTGACGCCGTTCGTCACGTTCTCGTACTCACCGAGCTCCACGAAGTCGTTGAGCGGCTGCCAGGTG
TCGTCCGAAAGACTCTTAGCCTCCAGGTGGTAGCACGTGTAGCAGGCGAGCGCCGGGAACTCGGCGATGAGCTGGCGCAGAGACACCACCGTGTCCGACG
GACTCACGCTCTCGAGACGCACGGGCTGGCCGCTCTTGGCGGCGGGGGGCGCCACGAACACGCTGAAGGCCGGCTCCTCCACCGCCATgacctcttcttc
ctgccgctgcagctccgactgctgctgtgcctgctcgacgatgtcgctgctgcccaTGCTAATAGAGGGAAATCTGGCTGCTTGCGCTTTTGAGCTCTTG
TTGCGATCTGGGCGAAAGGCAAGTGCGTTGCAATGTGTGGTGCGCAAACGATGAGCCATTAAGATCGGATTTGACAGGTATGTGAGGGCAGAGGATTGAA
GTTGTATTGTTTATGGTGTATGCCTAAAAATATGAAAACTCCGTGTACAGCATGCTACTCCTTTTTCATGATTCACGTTGTTTTGGAGGTAATTTACGCA
CCGGAATATTGCCCTGGGAGTATGGGAAAGCACTGCAAGCAGCCTTGACACcaataatacatgtagctgcaaCACGCACCGGCGTCAAGCGCTCGAAGTC
TGCTGCACCAGGTAATGCGTCAGAGCCGCATCCATCGAGACCAATGCTGCGAATTTGGCCTGATCTTGTACCCATCTTGTGATGGATACCGTGGTGTGCG
CTACACAACTTAATCTCTGGTTGGCATGCTCGTCAGCAGAGCTCTTCGCCGCAGCCTTCTCGTAGCGTCCGGGCCCTCGCTGCCGCGCCGCTCGCTTTCC
CCCTTTGCGCTCCGAGCCATGAGTTCCGACGAACGCGCCAAGGccgacgctgcagccgccTCAGGCGCCGCTGCCGGTACCGTGGGTGAGACCATCTTCG
ACAAGATCATCAATGGGCAGATCCCGGCCAAGATCGCGTACGAGGACGAACAGTGCCTGGCCTTCCACGACGTGAACCCGCAGGCACCCGTGCATATATT
GCTCATCCCCAAGAAGCGCGATGGTCTTACACAGCTTGCGCACGCGGAGGAACGCCACGAAGCCATCCTGGGCCACCTACTGTACACTGCCAAGTTggtc
gccaagcagcagaacctGGATAAGGGTTTCCGCATCGTCATCAACGATGGAGAGGATGGCTGTCAGTCGGTATTtcacctgcacctgcaccttcTCGGAG
GACGCATGCTGGGCTGGCCTCCTGGATAAAGGTGAGGCAGGCAGTTGCCTGTGCGTAGTGCTCGGCGAGAACTGCTCGCTGGAGGATGAGAGACGAGCAT
CACAAAATACTACTTAGTATTACTAGTATTAATCAAGGCACAAGCGCACAGTCATGTCTGTTGTGTAAAAATGCAAAGCAAAATGGATCAACTACTTGTT
TGCACGCCTTCTACAGCTGTCCGAATGGGTCCGTCTATCGGATCTACCCTCAGCCTCTGATCTCCTTGTGGAACTGGTCCAGGAACGTCTCCATAAAGGC
GTGACGTTCTTCGGCCAGACGTTGTCCGGcgttcgtcttcatcatacCACGAAGCTTCAGTAGTTTCTGAATTGTACGCAACCGTTATCAACACAAGAAC
ACCAACAAAAGTTAGAACCAAACACGCTGGCAGCATCTATCATAGAAAACAGTACCTCGTAGAAGTGGTTGATGGTGGTATTGGGGCGGTTCGGGTCCAT
GTACTGCTCCTTGGTCATGCTGTCAATTGGGGGCACGTTCGGATCGTAGAGCGGCCGCAGTTTGTGTCCTCCGAACGTGAAACAGCGTGCTATTCCGATA
GCTCCAATCGCATCCTACACAAGAACAGACGTAAGAACACAACCTTCTCATGTTCCTTCGAGACAGGGAACCTACCAGTCGGTCGGCGTCCTGGACGCAG
CCGTACTCAACAGAATACGATCGCTGACGAATTCAGACAAGATACTACGTCAGACGCAGCCACCACAACGAACTCAACAGCAGTAATGACATGATAACGT
ACCGCGCCCTTGCCTGCCAGCTCCTCTTTGAACCCCATGCTGTCGATAATGGCCATCACGCGTTCGATCTTGTCGCTGGGCACACTCTCCGACTGCAAGA
AAGCCAGTGCCCGCTTCGTGGACTTCTCCTTGTCGCTCTGGTACTTCcagtcgtcgatgtcatgcagcagcgccgccaggTCCACGATTTCCAGGTTCTC
CTCAGGCACGCGCTGTCCACACAGAAAGAGCCCCATCAGCTACAGCCAAGAGATCCAAGCATACTCAGCTGCAATGGCAcccacctcctccttcgccagc
gtcttcgccaCCGTCCAGACGCGCTCGATGTGGCGCCAGTCGTGCGATGCGTCGTTGCTCTTGAGCTGTTGCTCCACGAACGCCGCTGTGCGCTGCACTA
GCCGAGACGGAGCCATATTTCCACTTGACTGGTCAGGTGGATCTGACTCACTCACACCCGCCATGTCCGGTTTGAGTTGCCAAATGTTGGCGCCAAAATG
CCGGATTTAGGCTCGACTCGTTCTATTGGTCAAAATAAGtgtcagcttcaacgtcattTGAAACTCCTGTCATTCCCCCAAGCGGCAGCTAGACGACACG
ACGCTATGAGCAGCTCCCGTACGACATCCAGCCGAGGCCCGAGTTATGTGGCAGCGGCCACCAAGAGCGAAAAGCCCCGCAAGATCACGGCCAAggcgga
cgagctggacgcctATATGGAGAAGctctacgacgacgacgtcgagtcCAAAGTGGAGGGGGCCAAGATGATTCTGCAGCTGGCAGAGTTCGCGGGTAAC
ATCGAGGCGCTCGTGCAGGACGAGTCGCTCATGGTCCGTGCGGCTACGAATAGTGTAGGCACCAGCTGCATATAACTAATATTAGTATACTAAACGATGC
TGCCTTGGCTGTTGACTGCTACAGAGTCTGCTGTCGCGAGTGCTGAATGACGACTACAAGAAGAGCTACGACTTCTCGCTCACGATGATGCGCATCTTCT
GGTGTTTCTCCAacttcctccagctgcatCCGATGCTGGCCAACTACCGCATCGGAGCTATCACGCTCAAGATCGTAGAGTTTGAGCTGAAGCGCCACCA
ACTACGCCTCGAAGAGGAAAAACTGCTAGAAGCTACTGCCAACGAAGCCCCAACGGACTCAACGGACGGTGTTCTGGTAAAGCTTGACCGTGAGAAGAAG
CGTAATAAAAAACGCATGAAGAAGCAAGATCAACTACTGTGAGGATGCCGGTCTAGTtgtttgcattttgctctTTGGGCACGTATGAACTGACACTTGC
AATCGCTCCTGCAGCTATGTGTGTTTTGGTGTGCTACTGAACTTAGCCGAGGACATTCATACCGAGCGCAAGATGGTCAAGCGCAAGATTGTGCTGTTCC
TGACTAAGGTAAATTGTCTCTCCTGTGCTGGCAAGCACATGACCAGCGTAGTACTAACGATCGCTTTCATTGGTTGTCCTTTGTTTAAAATCGTTGAGTA
GTTACTGGATCGTGTAGCGCCTGATCTGGTTATCCTCACGATCACCTTtctcaagaagctgagcaTTTTCGAGGAGAACAAGGATGCAATGGTGGAGCTT
ACTGTAGTGGAAAAGCTAGTGCGCTACGTCAACTGCAACCACGACAAAACAATCCAGACAGCACTCAAACTGCTGTTTAACTTGTCGTTCGACCCAGCAC
TTCGCGAAGTACTGGTGAGAAGTAGTCTTATCCCAAAGCTTGTGGAATTACTCAAGAAGCCCCCTTTTCGTGCGCTGTCACTGCGAATTCTGTACCATCT
CAGCATCGATGATCGATGCAAGTCGATGTTCACGTACACGGAGGCAATTCCGATCGTCATGCAACTGGTGATTAACTTTCCGCAGAACATTGTGGCGAAG
GAGCTTGCCGCTCTAGCTGTGAATCTCAGCCACAACGCGCGCAACACCGAGCTTATGTGCCAAAACCGCGGCCTAGAAGCACTAGCCGCACGTGTATTCC
GCACCCGCGACCCGCTCCTGATGAAAGTGATTCGAAATATCTCACTCTGGTCGTATACGCTGCAAGAAGATTTGGTCAGTGATAAGGCGTACAAGTACCG
TGGCATGTGGGCCCCCTTTGTGGTGCCATTCATCGAGCTTTGCCTCAACACAGACAACCACGACTTTTCAATTGAAGTTCTGGCGACGCTAGCAAATATG
ACGCCGAGCGATCTACCTCCGAAGACTTCGTGGGACAGATTGGTGACAGATCACTCGCTAATCCCGTTCCTCAACAAACTCCTTGTGCCGGGCTTTTCAC
AAGATGACATGATCCTTGAAGTCGTGCTTTTTGTCAGTGCGCTCACATTGGAGCCGAAGTGTGCTCCTCTTCTGTCGTCATCTCGGCTTGTGCGCACGCT
CCACTCGCTCTTCCAGGAGAAACAGCATGATAACGAGCTCACCTTACAGCTACTTTATGCGTTCTACCGCATGCTGCGGCACCCCGAGACGTTTGAAGAA
ATCCTCTTTGGTGTTGGCTTTGTACCTGACTTACTTCTCGCTGCTGATGCACCTAACATTGAAGTGCGCCGGATGTGCGACGTGCTCATGGACTTGATTC
TTGACCACGACCTCAATGATGGTGGAACACTAGGTGACTTTGGACACCTCATTCGGCAACGTAGATTTGAAATACACAACGCGGAGTACCTCGAGATGAT
CCACGCTGAAACGCAGAGCGCAGCCTACCGCAAGCACCACGGGATGGATGACGACAGTGGCAaagaggacgatgatgatcACTGAACATGGCGCAACTTG
CTTCAACCCCTTAGGTATCACCCCATGACAATTGCACTTCTAAGGCCAAACTTAATACTCGGTCTTCTTTAACCTCCAACGCAGCTTCGCTTACTCAATT
CTCTTCTTTGCCAAGAACCCAACCACATTCTTACGATCAATTCCAAAGCGAGGCAGCGCCTTTTCCGGCCAGTATGAGTTGTGCTCACTGTTGATGGATG
CACCCGGCGGAATTAGGTACATGAAGTACGGACACTCCGGCGAAATAGACAGCGCAAGCACACGAGAGTTGTGCTTCCTCTTGTCCGAATATCGGACTAA
TTGTCGCACAAATTTCCAGTGATCATATGCGGACTCCAAGCAGAAAAATGCCATCGCCGAATCATGGAGATTGCGAACCTCGGTCTCCATTCTTTCCATC
CCCACAATTCTACACTGTGTCACCACAATACTGCGGCTAGAAGGAAATTGCTCGGGCACCATTCCGTCGCGGGTACGGCACCAGAATGCATCCACCGGAA
ATTCGTGAAAACGGCTAGTATCAGATGCGTCCTGGATCCGAATTAGACATGACCAAGCAACGGAGTCCCTGGCCATGCGCAATTCACcatcgatctccat
cttctcatcttcctcgttgAGTGGCTTCGTATCAAGCCCACAATCAATCAAATCAATCAAAAACTGTGCTGCCCTCCACTCAGCCAAGCGACGAGCCTCC
ATTTCTGTTTTCCACGTAGCCCGGCACAAGACATTACCATCTACTCGTACAGCGCAGTTGACACCAGGAGGTGAACGAGAATCACGACCAAATGACGTTC
GAGGTGGATCTTCCACTGCAGTTATAATCTGATGAGAAGACGAACAACAAAGAGATTCACGGTTAGTAAAGGAAATAATAGGTACACGCGAAGAAATGTA
CGTACACTAGCGATGCCTGACAACATGAGGTCCCGGAAGGAATCAATGGGCGAGACATATGCCAGAGATTTTACGTCCAGGAAATGAAGTAGTTGCGCCC
AGATCGATCGAATCTTGTTCAACTTGCTTAACATaccatcgacagcagcattgcaAGCATCAGACTTTGCTCCCTCCGACGCCTTGAAGCGAATGACGTC
GTTGACATCGACAAGAACTTCAAAAATACCTTCCCGAAGGCGCTCCATCTTGATATTGGCTGTGACATTGGGAACGATCCTTCTGTGTTCAGCTCCCCGA
TACTTTAGTGATGCTCGAAGCTTGTTAATACCGGCACATAGTTCATCTGTTGGAGTAAACAGACTTCGGATCGCGGCACGGAACTTTCCATCATCAGAGA
GACCGCTCTCGGACTGCTCAGCATACTCCTTTTTGAGTTCGCTTTCGAAAGCTTCCTGATCTGCCACGGCATTTGAATCTGGTGCGGCCTTGACTGCTGA
CGGATCCCAGTCGTCATCATTAAATCCTCCATCTGAGTAATTATCGTagtcatcgtcatcattatccatctcgtcgtcactgcacAATATAAGATTGGAC
TTTTTCACTGGAGTAATTGTCGAAGGACGTGATTGACTAGTCGCTCCAGATTGCGATGCTACAGCAGTATTTGCCGTATTCGTGCTTCCGTTCGAGAAgc
atgatgaagaagaagctgattTCAGCTTCTTTAGCAATTCCAGGATGTCGCGCCATCTTTCATTAGCAGAACGCTTGGCATCTTTTGCATTTAGACACGC
CGTCGAAATAGCTAGCGTATCGCGCACCATAATAAAATACATAAACATGGGCGGGACAAGTTTTTCCGATGTCGACACCTACAACCAATCGCAAGTATCA
AAGCAAGTTAGCCGATCAACGTTGCGCCAGTTTAACGAACAAAATCTTACCTTGTCTTGATTTTTGGCTTGTGTTTCGTTCCCAGCCATCAAAGTTGTTG
GAGTTTGCGCTAGTCGGTCGTTGTACGTGGAAAGCAACGCCTTCCACGTCTGGATCATCCCATCCAGCGTATTAATCAGAATCGAACCTGCCTTATCCTT
CGCGATTTCAATGGACGGTCCTTCCCCACAGGCCTCGACCACAGCCTCAGACGCAGAGAGCACGCAACGGACGAGCCCATCGTTCTGCTTTATAGCGGTC
CGGAAGATCTAAAGGAATTTAACGCAGTGCACACGCCACGTTACCGTACATGTAAGGCCCAATCGTATACCAACAACTCAAGTATGCGAGCTTACCGTAA
AACTGGACGAAAGCTTAATTGTTTCAGACCTGACGCTTAGATCCCACACGATCGCTTTGACGGTTTCCACAACCTTATCCCGATCTCGGAAGAGAAGCAT
TAACAGCTCCTGATATACGTCCGACTTCGCCTTTgcggcttcatcttcggaTCGGGAAGGTGCATCACGGTTGGGATCTGAGCCGCTTCGGTCCTCAACA
AACAGGTTTGCAGTGTTCACAGCGGACACGCTGTCACCTTTTCGCTCAGTGTATCGTCTTTCGGGCAGTACGGGTGTTTGTAACTCTGGGGTTGAATACG
ACAAGCGAGGACGGGAAGTACCACGCTCATCCTCACAATCTTCTTCTAGATTTGGCGCATAGTGTCGCTTTCGCAGAATACCCAGAGACCTTAATTCAGC
GTCTCTCCTTTCACCGTTTCCAATACTTCCAGCGTTTTCGTGCACGGTATCCATCTTATTGTAATCATCCGCCTCATTGTAATCGTATGTGCTTTCTTGA
TGGGGATCGACACTTTCACTCGTGCTCGGTTCGATTTCGTCCTTGATCTGCTTGATGCGGTCACGCTTCAGGCTCTCCTCGTACTGGTCAATTAATTCCA
TCAAGAACATCATAAGTGCCTCGATAACTTCGCTTTTCGTACTAGGGAGGGATAAACCACGTCTACAAATGAGAGGAAACTCTTGGATGAGAGCCACTAC
ATCATAAATGACGTTGCCGGGTTCTCCACTGGGACGCTCATGAAGCTGTGCACAACAGTAATGCATTAATCTCACAACGTCGCTGACCAATGCCTTGCAA
GTACGAACAAACGTACCCGCACAATCCTTTTTGTAATCAGATAGTTGAAGGCCGCGTCTTTCACTTTCCGGGTATCGTTAGCTGTACAGAAACCAAATTG
AACCTTCAAGTACGACAGCATGTCACCGTACAGCCTTCTGTGTTCGCTTACTGCTCTTGTCAGCCGCGACAGTGCACCAATGGTGGCATCCCGATCGATT
GTAGCAGTGCAATCGAATGACAAATGTCCTACCCGGACACGAGCACTGCACTGAGCCAGTCCAATCATCCGCAACTCGCACCGAAGCTGGGAAAAACAAT
CATCAGCTGCCGTAGCTTTTCTAAAAGCGTTTGAAAAACAGGAAGCTCACCTTCAGTCCCGGAGCCAATATGAGTTCCTTGTTCATGGCCAACAATGGCA
CAGTTTGAACAGCAGATATTAGTTCTTGAAGTGATGACACAAGGTCGACGTTAGGGCCGATCAGAGCGAGAAGATACGATCGGCCCTCATCTACACCAAA
GGTCCTGggcttggcagcagcgcgaactTCACTCGGTTGTCCCTGCTGAGGCTGGGGAGGTGAAGGAGCCGAggttggagctggagctggagcttcagcA
GGCTTAGAGATTTGTTCAGCAGTACCAACCTGCCCAGGCGCTACATCCATAGCAAATGTCACTCGTTTCTTCGAGACAACAGTTGATGGACCTGACGAGG
ATGATTGCGAGCTTTTCTGACGCAGTATGGAAGCAACGTTCAACTTGCCAGTAGAGTTGCCGTTGTAGCAATCGTTTTCAGGTTGTTCTGGGCTCATATC
GACCGCAATATCTTCCACcggctgctccagcttcttctccttggccatgacGGCATCCTTGTCTACGGTGACAGCCTCCTCAACTTCCTCTCTCGTGATC
GCTGCATACCATTTCCGGAACTCGTCTGCGAATTGAAACGTTATGTCTCCCATCAAGGTGTTTTTCGTGTCACCCGTCATAACCTTCACATacatcagca
acttcttcgctgcgtgcagtcgctgcacTGCTAGTCGGTCCTGCTTGATCAATTCGTCGTAGCGTTTGGCtagctgcaggtggtgggTGCCCATCTCGTC
GAGAAGACGCAGGATACGTCCGGGAGTGCGTCCTTGTCTTGGCTCCGCCTGTACCGACGCCCCCAAGCgcacgaagcgcagcaccacgacCCTCTCAGTA
GATTTTTCTAGCTCCTGCTTGATATTAACTTGAGCTCCCAGAGCAGCCACGTCCttgtggagctgcttgagttTCCGTGGACAGAGGAGGAAGTCCTCCA
CGCCCATCCCCACCAAATAGTCGTCCGCTTCGACGGTGCAGATGGGGGCGTTGGTTGAGGATCTGCCCGCCACGTTGTCTACAAACTCCATTGGATACTG
GGGCGATTCTGTCTTCTGCACTTGGAACACGTGCGAGTTCATGGTAGCCGTCACGGAGAGCCCGAAATGGGTGGccagctgcaggttgtccACGGGACCG
CGAGGCAGCGAGTAGTGGACTTCGTAGGCGCGccccagcgacagcagcttccgcgCAGCGAGAGCGACTTCCACCCGCCACAGACGCACGCTCATATCGA
ACGCCAGAGCTTTGTTGGTCTCGGGCAGAGCTGCCGACGGGCCCACGCTCTCCGCCAACAACCCCATGCTCGTCGAAGTTCCGTTACTTTTGGCTACTTT
GACACTGGGGTAAAAAGTATGGTGGAGGCCGGGACTGCGAAAACGGATATTTTATTCAGAGATGGAGGCGCAGTCAAGGTTACTTCAACGCCCTCGTTGC
TTCCCAGACGAAGGAGGGACGCGGCAATAAAGAGAGAGAAGCTGTGTTAGATGCCGAATAGGGAGTGACCAGGACACAGCAACAATAGCGATAATAGTGA
GCCGAGTTCCGCGTTCCACACAAAGTTTGTGTCACAAACGCAACGTCGATCACGCAGTAAGCTAACAGGATTTATGCATAGGCCTTCAGCCTCGACCTCG
AAGCACTACTCCATTAGAAAGATGCGGCTGGCAACGTCGCCGACTAGCCAGTCGATGCCGTCGACGAGGCCAACGCCAGTGACGGCGCTACAGGAGATGA
TACTCCAGTGTCGGGTAGAAAACTGAGCTGACCGCAGACCAAGCGCATCTGCGATCTCTGCAGATGAGAGAGCCCCAGGTAGGTCCTGCTTGTTGGCGAA
GATTAGTAGCGTAGCACCCGCTAATTTCTATTGGAAATAGCGATAATGAGCAACGAAGCAAGCGAATTAGTTAGTTAACTTCAAACCAagtgcagaagac
gattgATGAAGCACAAATAAATACACACCTCTTGAGTCAGCAAATTTGTAAGTTCGCGCTTGCAATCCTCAAGTCTCCGTCGGTCGGCGCTATCCACCAC
CCACACGAGGCCATCCGTCTGTCGGGTCACACACTGTTAGCTTTACCACGTCCACACACCTGtaagcagccagcagctggcATCCAAACCTGCTCAAAGT
AGTTCCTCCAATACGACCGAATCGTCTGCTGGCCACCGACGTCCCATAcattcaacttgaagctaatacatgtagagacAGCAACAGGCAGCACAAGATG
GTCATGAGTCTTCCACATGGTCAGTCCGTATCCAACTAACTCAAGCCCTCACGCACTCCTTGTACTCGAGAGTCTGGATGTCGAATCCCAGCGTGGGAGA
AATCTCTGTGATGTCCTGGCCCATAAACTTCTTGAGgatcgtcgtcttgccagcgTTGTCCAGGCCTCTGGCGATCCAAATCGAGCGACAGCGCCAGTAA
ACACATCAGCTCCAGTCAATTTACGGACCCGTTCCCAGCAGACAAAGCGACGATTGCAACGTATCAACGCACAGCATGAGGACGCggatctccttctcct
tctccttgaccttcttgagGATACTCAACAGCCCCATCGTTTCCGCAGTTCTCGATGCCTTGGCGACGTAAATGAAATATTACAGTCTAAGATGCAATAT
TTTATATTTTATTGCAATATTTCCCATCTGAAGGGACACGAAACGACGCGGAGGTTCAAGCCGAACGAGtagctggagcagcagtagccGATACCGCCAT
GACCAAGGCAATTCCACTCACACGcttgctgatgaagaagcctGACGGCAATCAGGAGGATGCCCACGCGCCGGAGCGAAGCCGTCGCTCCTTCAAAGTG
CACTTTcctctggagcagcaacagtctCCAGACTGgggcgaagaaggcgcagagTGGACTAGCACTGGGAAACCTTGCAGACCGACAGcactggaagagc
tgctgggtCTGGAACTAGATTTGGTCCTCCCTGCGACCAAAATTCCAGCTCCGatgagtacatgtaatcaGCTGCCAGCTTCTGCAACGAGGGAagagga
gatggagaccgATGTCGACGCTGTTTCGTTGGAGATCCTGGTGAGAAAAAAAATGTCTGCGAGTTAAACCGTCAACAACAACTCACTTTGTTCGTTTGTG
ATGCTGCAACAGGCAATGCAGAGTCCACATGGCGAGAACCAACAGTGGCaaagcgacgaagaagaacatgatgTGGACTCCACCCCAagcacagcaccag
ctcggccAGAGCATTCCCCGCCGCGCAAGATGAAAGAGATGTCGGCCTTTAGAAAGCCCATGCCACTCAATCTCATGTCACCGACGTCGTTTGTTCCATC
GTTCCCTCTGTCACTCACCCAGTCGTCAACAGACGATGCCTACGGTTTGGCATCACCCATGACGCTGCCAGACACAACTTCGCAGACTCGTCCAGGAATC
GCTTTGGCCTGGAATCTTGAACCAGCGTCTCCAATATTACAAGACGCTCATGTAAGAAGAGGAGCTTCTCATCGTTTGCCACAATCCAAGAGCGTTCAAA
GGCCAGATCGTCGAGCATCATCAGATTCGATTGCAGGTAGAGCTGCGACCCCAAACCCAAACAACTACAGAAACTATGTTCCGGGGAGAGCTAGGATAAC
AAGGTCTTTGCTCCCAACGTTACCAGAAGTTCGAGCCAAGGCCAGGCACGGCGGGATCTACTCGTTGCTACTGAAGAATACATCCGTGAAACAAGAAGCA
GTCCTCGTAGAAGACGCACACAACCCCGAAGGTACGATCTGTCCTCGTTGCTTTTAGCTGGTTAAGAGATACTTTTGTCCTGATTGGTTTGATGTGATAC
TTATCCTTAAGAGGTGGCGGCGGAGCCATCCGTAGCCAAGGTGAGTGCATGTTCAATACCTCCATGATTCGGCCAGGACGGTTCTGACATTGATTGCTTC
TTGTCTAGgcatcaccaccacgcaAGCAGACGCACGGAGGTATCTACAAAATCCTTCGAGCTAGCCATGGGCCTCGTTAATCACCACACAGTAAACGTCT
TCTACTATGAAGTAAGCAGCGCTTGCTCtcggtgtacatgtacatttcCGGTGGCAATAACTTGACGGCCAACCTGAGGTCTACGTCCAAACCAGATCGA
CGGCTTTTTAAACCCAAAACGTTATCCTCCACCCTTCGGTAGACTAGGTATTAATCCTTAGCCGAACAGAGGAGCTCAATGAGCAATGTCTCTGTGACGC
TCAGTGTGAGCTCAGTCCTGATGCGTGCGCTTGaaagacaacttcaagtgGATTTTTCGGCAAGtggataccggtacatttGTGCTGAAATGATCGCAAT
TGCAACCTCCGAGTCACACACAAGATGAATCGCATAttcggcaagaagaagcccgagGCGCCGCCCGTCAACATTTCCGATGTAGGGGGCAAGGTGGACG
CCCGTGTCACTGACCTGGACATGAAGGTGGGTGCCTGTGGTTGCAACTACTCGGTTGGGAGGGAGACGCAGTGGATGCTGACTTTTGCCGCCGCAGATTG
AGAAACTGGACCAGGAGCTCCGCAAGTATCgcgagcagatgaagaagacgcgagGCCCAGCCGTCAATTCGATCAAGCAGCGAGCCATGCAGACgctgaa
gcgcaagaagatgtTCGAGGCGCAGCGggacaagctgcaggccCAGTCCTTTAATATTGATCAGGTGTGGCGGGGCTGTTGCAGTGATGTGCTAATATAA
TAGCCCAAGGCGCTGATGCTTCTGTGTGTGCTACGATGATCGTGCTCTGGCTTGTAGGCGGCGTTTGCGATTGACACATCTAGGGACACAATCTCTACGG
TTGCTGCCATGAAGAGTGCAGCTGTGCAGCTGAAGGCTGAGACCCAGAAAATTGACATCTCGGAACTGGAGGTGGGTTGGAAAGAGGCTAACTGTGCATG
GTGCTGAGCTATCGGGTTGCTCATAAACTGTGTGCTTTTGCGTGGTGCAGGACGTGCAAGATGACATGGCCGACTTGATGGAGGACATGAACGAGATCCA
AGAGCTCATGGGCCGCTCCTACGGGTACGTGTACGCGGAAATCCTAGCAATCCAGTGATTCAACTACGAAATTGCACCTAACTGTCCGATGCTCGCTTGG
TGTCGCCTCCGTTGCCTCTAGCATCGGCGATGAAatcgatgaagacgagttGGAAGCGGAACTGGAGGGGCTGGAGGAAGAGTgggccgaggaggaggca
ctCGGAGAGGAAGCGGAGCAGGCGCTATCCTACCTTGCGCCggcgcagcaccacgagctgccgGCCGCGCCCTCCGGCATATTAGACTCCGGCACGACGG
CGCGCGCTACCGACGAGTTCGGCCTGCCCGTGGCGTCGTACTCAACGTAGCGCTGCATTCTGTACACGACACGGTAAACACACAGAGATCCTACAGAGAA
TATACGTAGTCCAGCAGTTGCCGTTGCTGCCAACCATGACGACGCACTTGTCAAGCGAAATGGGAGAGATGGATACACTACGTCCGAGCACGCGATTGGC
CGAGCTTAGACAGCCAATCGTTTCTCGGAATCAAGTTAGAAGGGGTCGAAACGATTTGACAAGGATATGCTTTATAGAATTCTTGTTATGAAGTACTTTG
TAAGCGAATCCTGTCACAAGCTATCATCTCTCGCAACAACACGAGGTTTTAATCGCAGCGAGGTTTTATCCTGCTCTGCGCCACGCATTTGTTTGGCTCA
CTTCGGTATTGGTGGTTTTGCAGACTAACAGATCTCAAGTAGCAGCACAGCAACCATGGCtcgcgagaagaaggagccgcgcgtgaagaaggagcgcaag
ggcaagaaggaaTCGCGCAAGAAAGCGGctgaggagaagaaggcggccGAGAAGGCCGAGGCGCTCGAGAACATGTCGCACGCCGACCGTCTCGCTGAGG
AGGGCATCATCGCCACCTGCTCGCACAATGTGCGCTCGGTGCACAAGAACTTCAAGGACATCAACGTGCTCAACTTCAGCATTACGTATTTCGGCAAGGT
ACTCATGGAGGAGTGCGACATCTCGCTCAACTTCGGTCGTCGCTATGGTCTCATCGGCCGCAACGGCTCGGGCAAGTCCACGTTCATGAACGTGCTGGGT
GCGCGCGGCATTCCCATCCCTGATAGCATCGACATATACCACCTCAAGCACGAGATCGAGGCCAGCGACATGACAGCGCTCGAGGCTGTGCTGTCCGTCG
ACGAGGAACGCAACAAGCTCCAGGCCGAGGCCGACGAGCTCTCAGAGAAGATGACCGACGAGTCGATCAGCGAAGAAGACAGTGAAGCCATTTCGGACCG
TTTGACGGACCTGTACGAGCGTCtcgacgacatggacgcGGCGACGGCCGAGGTCCGTGCTCGCCAAATTCTGTCGGGTCTGACGTTCTCGGACGCCATg
atggacaagaagaccaaggagTTCTCTGGTGGTTGGCGTATGCGTATCGCCCTGGCTCGTGCTCTGTTCATCCAGCCgacgcttctgctgctcgatgagc
CTACCAACCACTTGGACATGGAGGCCGTCGTCTGGCTTGAAGACTACCTGtccaagtggaagaagatTCTACTCATGATTTCGCACTCGCAGGAGTTCAT
GAACGAGGTTTGCACGAACATTATTGACCTCACCAACAAGAAACTCGAGTACTACGCCGGTAACTACGACACGTACGTGCGCacgaaggcggagaaggag
gagaaccAGATGAAACGTTACAACTGGGAGCAGGAACAGATCAAGCACATGAAGGAGTACATTGCCAAGTTCGGTCACGGTTCCGCCAAGCTTGCTCGCC
AGGCTCAGAGTAAGGAGAAGACGCTTGCTAAAATGGTGCGTGACGGTTTGACGGAGAAGGTTGAGCAGGAGTCGATCGGCGACTTCAAGTTCCCCAACCC
CGAGCCACTGCCGCCTCCAGTGCTCATGTTCCAGAACGTGTCGTTCGGCTACCCGAACACCCCTTTGCTGTACTCTGGCGTGGAGATGGGTCTGGACTTG
GACTCGCGTGTCGCCCTTGTCGGTGCCAATGGTACGGGTAAGACCACCCTGCTGAAGTTGATCACGGGCGACCTGGTGCCTGTTGCAGGAAATGTTCGAC
CACACAGCAAGCTGCGTATTGCGCGTTTCAGTCAGCACTTCGTCGATGTGTTGGACCTGACCAAGGCACCACTCGAGTACTTCCGCTCGCTTTTCCAGAC
CAAGTCCGTCGAGGAGGTGCGCAGCTACCTGGGCCGCTACGGTATCACCGGTGATGTGCAGACACAGATCATGGGTCAGCTGTCTGACGGACAGAAAAGT
CGCGTCGTGTTCGCGTACATGGCCCAGCAGAACGCACACATGCTGTTGTTGGATGAGCCTACGAACCACTTGGATATGGAATCTATTGATGCGCTGGCCC
GCGCTATCAACAACTTCGAGGGTGGCATGCTGCTGGTGAGTCACGACATGCGATTGATTTCGCAGGTCGCCAAGGAGATTTGGCTTGTGGAGAATCAGTC
TATTAAGGTGTACCAGGGGGAGATTTCGGACTTCAAGATGCGTGTGCGTAAGCAGCTTAAGCTGGCGGACAAGCCTGTCACGCCTGCCGAAGAGTAAGTG
CTCTCGACAGGTGATTGATCGCCCATTAGATgcttgctacatgtagaactGCTGTGGCGAACGCCGATCAGGGCGCGCTATTCTGTTCATATTTGATTCC
CTTGCCGACTGATAACACAGATTGGATAATCACACGTTGCACTTGATGAAATGCTTTATCCATTGATGATCAAGGTACTTACGGTTGTTAGTCATCTTCA
TTTTGGTTGTTGTCTTCGTTGCTGACTGCCACGCTCTGATCGAAGTCGCTGGTAGTGAGCCCATCGCGATCGACGGTTCTCAAGTCACTGACCGGACAGT
GGACAACTGaactgctgttgctac