Description :
From Genome Similarity Track
Location :
Scaffold_2804:1151- 2256
Sequence
1105 bases(100 bases per row)
ATAGGTACGTAGCCTACAGAGTCCAAAAGGGATAATGCCTGAGCCGGCTATCACCATGCAACCTTCTCCACCTCCAGAGAGGCACACGGCGACACTAGTA
AACTTTTCTGCTATGTCTTGTCTTGAAGCAAACTTGGACGGTGCTCAGTCTCATCATGCAGGTCTCGTGACGAGACATCCGTTGAGCAGCTCTCGAGTCG
ACGCAGCATTCTCCTCAAGTCTTACGTCCACGCTGGGAGGACCGCCAAGTATAGCATTTTTTGATGTGGCGGGTAGCTCCTCAGCACCAAACAACGAGCT
CTCGGGTCTTCCTAGGGGGGGGGGGTTAAATAAGCATTGCTTGCTCACATGCCAAGTTCGAAACTCTCATTTGATTGGCTAATAATGGCGTAAGATGGTG
AAGTGCCCGCGGTACTCCCCGTTGAAGTGCAAATGTGAGCGCAGGATAAAAGCACTCGTAACCAGAATAAGGTTTGCCTCCGCCCCATGGGTGGGAAACC
CTTAGCTGGCCTTCAAAGTCCATCATCTCTATTACATAGTTCTAGCAGTATTCATACATGCCGTCGCCCTTGTACGGCACGCGCGTCACGGGCTAACGTA
CACCTAATCTGGCGTGGCAGTGTGTTGGTGTGTTCATGCTTCCCCACTGCACGCTGCATCAGTTGCAACTTTCGTTTGGTCGTTGTTGTGGGGTCCTTGC
GCTGCGTCGGTTTGCAACCTGGTTTCGTATTGGATCGAGTGCAAAACTGGATGAGCTCTGCTACCGTTGCTTGAACGGAGAGGGTTCCTTCGAAGAATGG
ATACAAGTGTGTGGAATTGTCTAGTAGTACTTCGAAGTGCATGCACAATGTGGATTGGGTGCTGCGTTTACCGATTGAGAGAGGGTACAGGAGCTGCTAC
GGGAAGCGAAAAAATGGTTGTAGAGTTCGCTCGCACTCGTTGGCTGGCGGGAGATAGAGTCTAGGACTCCGTACGGCCATGCTACCGGAGCCAGGTATTT
GGCAAAGGCATACCGGTACATATCCTAGCTGTCTTTCACGGCTGGGAAGGTACGGTTCAATTCGACAACTAACGGATTGTCCACGTTGTCAAGCCGCAGC
TACTA