Description :
From Genome Similarity Track
Location :
Scaffold_194:115051- 120072
Sequence
5021 bases(100 bases per row)
CTTCCTCTGACGCTAAAGCTACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCCGCTCCTGAGTCGGTTGACTATATCCTCTGCGAGGATGG
AACACCCCGTGTTCGCGAATTTGCTTCCGGCGCAGCAGGACGCGCTTACTAAGCTTATGTCCTTGCTTGGCCCGGAGGGCGTGGCTCAACTTGCATCGCA
AGGTCCAGAGGCGGTCACTGCCAGGCTGGAATCGTTCTCCCGCTACGAGAACGCGCTCTTGGAGCATGTCCAAGAGAAGATGAGCGCCGCAACGGCGGCG
GCGTCGATGACGCGTGAAGAGTCTATGAGACTGAAACCGCTCATGGTGAGCGTAAAAACCTTCGAGGGGAAGGATGGAGACAATCTCCTTCTCTGGACCC
GTGAGGTCGAGATGGCCATGGGATCGGCCCTGCTCCAGTCTGAGCATCAGCGCGTGGCGCTGGCTATCTCCAGGCTTGGAGGTCGCGCTCGCGAATGGGC
ACTAACGTGCGGCACTTCTGTTGACGCTGCATTTCCCAGTTGGGATCAGCTGAAGCAACAGCTTTCGCGCGTGTTCGCGCCGCCTAATCAGGCGTACCGT
GTCCGGTCAAAGTTCCTTGCTACCCGCCAGGGTAAGAAGGATTTATTGGACTATGTCCAAGAGTTGAGAACTCTTATCGCCGGAATGGCGGCGGACCCTC
TTCCGGAACTGGTCAGCGTGACCGTGTTTATGGAGGGACTTCGTGTGAGCGCAGCTCGAACGGAAGTGTTCCGTGTACACTTTAACTCTTTTGAAGAGGC
GGTGGATGTGGCATTGAATGCCGAGCACAACTTCAGGTCGGCGCGACCTGGTTGGAGCGCTGGTAGCGCAAGCTCTTCGAGCGGTCCAGAGCCGATGGAC
CTCAGCTATGCTGAAGATGAAGAAGCGAAGCTTCTTGCTGCGGAGCAGCGCGCCGGCATCCGCCGATGCTTTGTGTGCAATAGCACTAAGCACTTGAGGG
CCTATTGCCCTCTGCGCAAGAAGCGCGAGGCTCCGGCGAGCCAACCCTCCGGGTCATCGCCGGGAAACGGCAACTCACAGTAGGCGCGGGGCGGCCTACT
GGGGAAGAACTGAGTTCTGTTGTGCCTCGAAGAGGTAGAGGGCAACGGGGCTCAGCCCCGAAGAGAGCTGAGCTCTCTTACGAGAAGAGTGTGTGCAAGC
CGGGCTTGCTGGTCGTTCAAGCGAACGTGAAGGCTTGCAAAGGCATGGAGAGTCTTGATTGACTCGGGAGCCTCGGGCAACTACGCCCGTCGCTCCACCC
TAGAAGGGAGTCAGCTGTATGCTGAGGCACTGGAAGTGCCAACGAGAGATACGATCTCTGTCCGTCTCGCGACGGGGACACTGGTGACTGTGTCGAAGGT
CTCTGTCGACCTTGGAGTGAAGTTTGAGAACTTCGATAGCGTGGAACGCTGTTTGGTCTTAGACCTGGATGCGAGGTATGACCTCATCCTTGGCATGGCA
TGGCTGGAACGTCATGAGCCATGGATCGACTGGAAGTCGAAAACGCTGGGTGCGTCGCACCCTGCTCCTAGTGGAGCTTTGGTGAGTCATGAACCCACCT
CTGCTAGGAAGCAGAAGCGCTTTTGGCGCGAGCACGAGGCCGAGGCGGCCGTAGTGCTGGACATTGGTATGTCCGAAATTGTTAGCAACGAGGTTGCTGT
TTGCCCTGAGGGCGTACGTGGTGCGGCACGTTATCCGCGGAGCGGTGCAGGTCAGGTCAATGACCAACTGCTGGGTCCTGATGAGGACGAGCGCGGAGTG
GCGCGTAATCCACTGAGTGGTATGAATCTGGTCGATGACCTACCTCTGCGTGACCCGAGGGTCGCGGTCGACTGCGAGTCGAGGCATCATGGGCGTGGCC
CAGGAGATGCAGGTGAAGTGACACCTAATTCACTGTGTGAAGGTCAAGAACCTCTTGGCTTTCAGCCGAGTGTCTTGCGAGACACTGTATCCTCTTCGAG
GAGTGATGGTGCTGCTGCACCCGGTGGTGGTGACGGAGATGTCGCCACACCGCCCTCATCCGGCCGGGCTCGGTCGCGGAGGGAGAGGAGAAGAAGACGC
AGGGCGTCTGTGACGTCTTCGACGTCGGACGATGTGTCCAACGTGACGAGCGGTGATGCTCCACGTGATTGCTGCGAACAGCTGTATACACTCGTGAACG
GAGTGACGGGGGAGGTAGAAGGCGATATCAGCCTTGATACTCTGCCCGCTGCAGATGCTCTGCTAGAGCTGGACGAGATGTCCATTGCCGAGTTCGGCGA
AGCCTTAAAGGCAGGCGAGCTAGCCGAGGTGGTCTTGCTGGGACCTGAGGAGGAGTTGAACTCCTCATCCGTCGTGGACGACGCGGTCCTAGAGGACACC
AAGAAGGCGCTGAGCGCAAGAAGTGGATCGGCGATCCTCAAAGATCCTTCGGATCCCTTCTACCCGGTGGTGAAGGAGTATGGAGACGTTGTCTCAAAAG
ACCCACCGACGGGCCTGCCTCCGGATCGAGGCGTGTGTCATGAGATTGACCTGGTTCCTGGAACCAAATACTGCGTAACAAGGCAATGGCCTTTGCCGAG
AGAGCAGTGTGACGTCATTGACGCATTCTTCCGTGCGAAGCACGAGGCAGGGATGGTGCGTGAGAGTAAGTCTCCGCACTCGACACCCACGTTCTGTGTC
AGAAAGCCGAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTAAATGCGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGAATGTTCTGC
AGAACAACATGGTAGGCTGTACGCTGTACAGCGCGCTCGACTTGGTCGATGGCTACTACCAATTGCTCATGAGAGCGAGCGACATTCCGCTGACAGCGGT
GAGTACTCCGAGCGGTATGCTCTGGGAGTGGCTGGTGATGCCCCAGGGGCTGTCGAACGCACCAGCAACGTTCAATCGTCTTGTGACGCAGCTGTTTAGG
CCCCACCGGGCGTACGCTCAAACGTACTTTGACGATATATTCGTCCATAGTCGTGCCGAGCACGGAAAGTCAGACGTGGATAACCACATTGACCACTTGC
GAGCGGTGCTCGAGTGCATGCGCACTAATAAGTTGTATGCCAGCTTGGACAAGTGCGTCTTTGGCGCGGAGGAGATACCTTTCCTCGGGTGCTTCATTGG
GAAGCGTGGCTTACGGGCAGATCCTGCCAAAGTCAAGGCCATCGTGGACTGGCCGGTTCCCAAGAACCAAAAAGACTTACGCAAGTGGCTAGGCTTAGCC
AATTACTTGCACAAGTACAGTGCGAACTACGCGGAGATGGCTCGGCCATTATCAGATCTCCTTAAGAAGGACGCACCATGGTGCTGGAACGTCGAGCACG
ACGGAGCCTTTGAGGCTGTGAAGGAGAGCCTTCTCCAGGCTCCGATCCTTGCGCTACCGGACCCGGATAGTCCGTTTAGCGTCGTCTGTGACGCCTCCGA
TTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTGAACGCGTGATCGCGTTTGAGTCTCGCCAGCTCAAAGCTGCAGAGAAGAACTAT
CCAGTTCATGACAAAGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTACACCTGCTAGGCTCTAAGCCTTTTGTGATCTTTACTGATCATG
CGTCGTTACGCACTGCGACACAGTCGCCTCATCTCTCGCAGAGAATGGCAAGATGGCTTTCCTTCTTTGCCGAGTATAACTTCGAGGTGAAGTACAAGCC
GGGGCGGCTTAATGTAGTGGCCGATGCGCTCTCGCGCAGGCCGAGCTACGAGTTAGCTCATGTCACGACAGTGACGTCTTCAGTGCCTGACTTAATACGC
GGAGCGTATGCACAAGACGACATGTGCGTAGCGCTGCTACGGGCTCTTGGGAGCGAAGAGTTTAAAGACTCTGACAAGGAATTGTCTGGGCGCTTACGCG
CGAGGCTGCATCGATACTCACTCGATGGCGGCCTGCTGTACTACAGCACCGACGCTGAGGATAACCCTCGTGTAGTCGTTCCTCATGATGAGGATCTAAA
GTATCGAATCCTCTATGAGGTTCATGATACGCCCGTGGGCGGGCACTTAGGTCGGGAGAAGACCTATGGCTCGGTGAGCTCGATGTACTGGTGGCCCAAG
TTGTATAAGTGGGTCGGCACCTATGTACGCACGTGTGAGACGTGTCAACGGACAAAGTCCGCGTCGAGCACGGCAGCGCCATTGGCGAGTTTGCCTGTCC
CCAAGGGATGCTGGCAGTCCATGAGTATGGACTTTGTGTTTGGCCTTCCCAAGGACAAGGCAGGAAACACAGGTATAGTGGTCTTTGTAGACCGATTGAG
CAAGATGGCTCATTTAGCGGCAGTGCCGGACACCATTGATGGTGAAGGTACAGCTTTGCTGTTTTTAGACAGAGTCTTTCGCCAACATGGCTTGCCTGAG
GCAATTGTCTCGGATCGAGACCCGCGCTTCACCGCGAAGTTCTGGACGTCCCTCTTCAGAGTGCTTGGCACTCGGTTGGACATGTCCACAGCGGACCATC
CGCAGACCGATGGTCAAACCGAACGCGTGAATCGCGTTGTGGAGGATATCCTCCGAAGCGTATGCGCTGAGGCGCCAAAACGCTGGAGCCAGATGCTCCC
ACTCGTTGAGTTCGCATTAAATAATGCAGTGCACGCCTCGACAGGCTACACTCCGTTCTATGTGAACGGCTTGGCTAACCCTCGCGTCCCATTGACGCCG
CCACGCAGTGGCTCAGGGCTTGATGGGGGAGGGATAGCCGAGCGGCTAGCTGATGTCAGCCCTGTTGCGGTTCGCAAGCAAGTCGATGACTTTGTCTCTT
TGAGACTAAGCGTAATGCGTCAAGTACGCGACGCTATGGCTGAAAGCCAAGACATGCAAAAAGAACATGCAGATGCCAAAGGCAGACGCAATGAAGAAAG
GTTTGAGGTCGGAGACCTAGT