Description :
From Genome Similarity Track
Location :
Scaffold_379:11505- 14023
Transcript NameFunction/comments
Phymu_g9279casein kinase II subunit beta
Phymu_g9280hypothetical protein

Sequence
2518 bases(100 bases per row)
CCAGTGTAGTactcgctggagctgtggacCTTGTAGCCGAACACACGCGGCACGTAGGTCTGCGTGGGCGGCTGCACTACAAGCTGAGGGTGCGTCATTA
GGAACACATGCGGGAACGTCGCGCCAAAGTACGCTCCGTCAATCTCTACAGTGTCATAAGACAAAAAAGTTAGACTTAAACCTTCCACCAAATAATAAAG
AAAACGTACGGCCCGCTCGTTGGGACTTGGGGAAGAAAATGTCCCTGCACTTGGGACAAAAGACGTTGACCGTCGTGTGTCTGGGCACATCTGATTGACC
CACAGGCAGCACGGGCTGTCCCTGGCAGTAGACGCGATGGCAGCGGCCGAAGTCTACGTTCTGGTACTTCTCTAACATGGCGGCCATGCCCTTGGTGGTC
AAAATGTAGCGCGCGTGGATGAGTCCGTAGAGCATTTCCGCCGCAGACTCGATCATctcctgctggatctgcgtGAGGTTGCTGTCGTTGGGCGTCTCGA
TGTCCAGGATGATGTCCAGCGCGTAGTCGTAGTAAGGCACGATGCTGCTGAGCCCCGTGAGGTTGAAGTCGTCCTCAATgtagtcctcgtccacctcgca
CAGGAAGCTGTTCTCCCTCAGAGAGCAGAACCAGGCGATCCAGctcgtctcctcctcgtcgctgcctTCCACGTCattgtcctcgtcgtcatcgtcgtcg
tccaagctggaatcctcttcctcctcttcgtcctcctctgACTCGCTCTCAGACGCATCTGCCGCCCCTGAGACGCGTAGCTCCTCCATGTGACCGAATA
GACGCTCCATCTCGGCCTCTTCAGCGGCCTGGCTGCCGTTAACGGCGTGGTCCGCTGGCTGGCTCATGGCGCCCTTTGGACTGCCGATTTACGCGGTCTG
TAGGCTTTATGAGGTTAGAAACACTGCGATGTGCTCGCCAGTGTCTTGTGGTGACTCTCCCGGTGGTAGGAGAGGCTGGTGGGGCTCGAAGAACGAGAGA
TTCGCACCACTGCAAGCAGCAATCTAGTGGGAAAACCTAACGAAGTCCTTCGTGTCCAGCAAGCTTTTCACGCCCTTAGCTGCAGTCTTGTGTATTTTGC
ACACAAGAAAAAAACGAGACTTTACCGGTTCAATCCCGGTATCCAAAAGAAGGATTTCATGGTCGGGTTAAGCAACCGGTAAAGCAAAAAGCCGATTTGA
AACTGCTTTTTCCGCTGACCTAACAAAGTGCTTTTTAATATACCGGTTCACCAGCcacttgaagagctcaaATGGCGGCAGCAGATCGAGATGGCACAGC
GACTTGGTACGAGGCCTACGCCTCGGGAGATGAGGAGCGACGCCTGCAACAAGAgggagatggagaagactATGAGTATGAGGAGGTAGAAATAGAGGAG
ATGACAGATGACGAGCCAATGCACATCACTAGCAGACTCTTCCTCGGGTCCATTGACGCGGCAAGGAACGTGACTGCATTGAAGCGACTGCGCATCAGTG
AAACGCTAGCGTTGCTGGCCattggagaagatgatgctgcAGTGCCAAATGATGCAAGTGGTGTCGTGCCGGAAGCCTATACGAAGGTGGGTATTAACAG
GACCCTCATAGAGATTGAGGACTCAAAGAACGGAGACTTGGTGCGGAGATTGCCGGAAATATTGGCAAAGCTAAAGGAACTTGTGTAAGACGACGCTTGA
GATTGTTTGGAGCAGCATTGAGGTTGATTCTTCTGTTCTTGATGGATTGGAAATGAGTAGGGAGAAGGCCGAACGGGACGACACGAGTGTGCTGGTGCAT
TGGTACGTACAGTTACAGCTTTACTGGTTAGACAGCTGAGGTGATCTAATTTATGTTtgcactgtacatgtagtttcGCCGGCAGATCGCGGTCTGCAGC
CGTACTAGCAGCTTGGATGCTTGTCAACGACCCGAAACAACCGGATGTGCAGGATGTCGTCGATCGGATAAGGTAAGAAATTCTTACGAAGAATCCCGGC
AAGAATGCGTTGGCGTCTCTAACTCTAACTGGATCAACGCAATGCAGAATCATCCGCCCGTGGATCGAAATCAACTCCTACTTCATGCAGGACTTGCACC
TATTCCATGCCATTCTAACCTTGCCCGATGGAGATTCACTCACGGCAATCAATACCGTACAGCTGCAGGATCGAACATTTCCCCGATTGGACTTCGGTTC
AACCCTTGTCAAAGAAATCCTGCGAGGCACCAAGACTATTACGATGCGTCTCTTGTCCGACATTGAAAGTGACCTCAAGTCCGACTTGGGAGCCATTTTC
CCATTCTCCACTGTtgctgcgacgacggcgagttcTGATTCCTCGTCAGCCAGATCACGTTTCGCCTATCTGCGGATCGACCAGGTTGAAACTCGTGACC
TGAACACCATCGACGACGCTACGCTTCGTAAATCTGGCTTCGAGTCAACCCATGAGGTGCTGTCGGTGCTTAAGCAGTTCTACCCCGACGTGACGGCTTC
AACCCCGCTGTTGATGCT