Description :
From Genome Similarity Track
Location :
contig_61:115047- 117720
Transcript NameFunction/comments
g9195.t1hypothetical protein

Sequence
2673 bases(100 bases per row)
CTTAGAGTGACCACACCGGTAGTTGCTATTGCTATCCTATATTTAGCAGCGAAACCACATGTCCCCTGGCTGATAGCATCAGCCAAAAGCCAATTTGACA
CCGGTGGTGCGGCTATTAACTACGTTGAAGCTATGGTTGATCGATTTTCGTCGTCTTGGTTGACGGACTTGCTTGATGAGGGGATGAAGAGGAGCTTTTG
TTCTGAATTTAGTGTTGTCTAAACCTAGAGGATTGGATTTGTCGTCGTATCCGGTGGCTCGAGGCCAGGCAGAGCCGCAAACAAAGCTCGTCGAGCGGCC
GACCGTCATTTACGTCTTCTGCAGCAGTATTTCGGACCAAAACCAGTCTACGACTCATCAGCTTTTCGAAAGCGCTTTCGAATAACCCAACGTTTGTTCA
CGAAGATGCTGATAGCAGTCGTTGAGACCGATGACTACTTCGTACAGAAGGCTGACGCTACCGGTAAGCTAGGCATCTCGAGTTTGCTTAAAATTACTGC
TGCATTACGACAACTTGCATATGCGTCTGCTGCTGACGCGCTTGATGAAAACTTGGAGATAGCGAAACTACGACATTAAAATGCTTGAAACGCTTCTATC
GTGCTATCATCGCGAGGTTTGGCAGTGCATATCTTCGGTCACCAACACCAAGTGAATTACAGGAAATTCTACAGGAAATGCTCGCCGTGGTTTCGTTGGG
ATGATAGGCTCAGTAGATTGCATGCACTGGCAATGGAGAAATTGTCCGACTGCACTGGCCGGACAACACAAAGGGAAGGAGAAAAAGCCCACTAAGATTC
TTGAGGCCGTCGCAGACTACAACTTACGAATTTGGCACTGCACTTCGGGTCTCCAGGTTCTCTAAACGATATCAACGTTCTGGACCAGTCTCCTTTGTTT
CAAGATTTTCTGCAGGGTACTGCTCCCCGTGTCGAGTTCGTGATATCTGGTATGATGTGCTTCTTCACATTGGCTTTCTTAATGACTGCAAACTAAATTG
AAACTCGTAGGAAAGCCGTATGACACGCCGTACTTGTTGGCAGACGGAATCTACCCTGAATGGCCTGTGTTTGTCAAACCTATTGAGAAACCCATGGATT
AAAACAAAAGCACTTCGTCAAGCGACAGGAAGCTTGCCGCAAGGACGTGGAACGATGCTTCGGTGTGTTACAAGCGCGATGGCGCATAATTGACACTCCC
TGTCGTCTTTGGCGGGCAGATGCAATGGCCCAAGTGATGCACGCTTGTATAATCCTCCACAACATGATCATAGAAGACGAGCTCAGTGATCCCTATTGCA
ATGGCATGAGCATCTTTACGATGCCGAGGCGCAGCCTGGTGGCATTCCAGTATTCAATATGTTAGGCCACAACGACCACCGCGATCTTCTACAGTTGCTA
CGCTGATATCTAACTCGCACAAACTTCACAACGCTAACCAGCACGCTCGGTTGAGATCCGATCTCACAGATCATCTCTGGACAATGCGCGGTCTCGAAAA
CTAGTTAAAATTTGCAATATACGACCCTTGTGGTTTGAACTTAAGCAGTGCTAGATAATTAGCGATGATACAACATCGGGTGTTGTCGTTGCAGTAACTG
TGGGGGATGGTGGGCTGCTGGAGTTAATGGCGCGGTAGTGATGGGCTCTGCTTGGCTGGATCCGGCTGATCACCAAGCCGAGATCCATGTCCTGCAGCTG
CAGGAGTCTCTGTGTCAACAGCAGCAACCTCTTTACGAAGTCGTGCTAACACAAGTCGTCGTTTGAGCGCGATGAACTCCATCGTCTCCGGGTCGCTAGT
GTTTGTTGCATGCTAAAAAGATTCTGATCAACTTGATCTTGAGCCACACGAACGCGAGCATCGGCTGTTTTCGCCATTCTTTCGGTGGCTTGCACTTGTC
TAGAGTAGAGAGCTAGGTTTGCGCGCTCCATTTTAGCACGCTGCTGCCCGATGGGCGCTTATCTTCTACTTCTGTTTCTGCTGTTGATGTACCATCGGAT
ATGCTACTCCCGATACCGTCCACAGATTGTAGTTCAGCCAAACATTCGACTGCCGTCCGCTTCCTGAGAGAGGTCTCTTGGCGTTTCCGTCTCGCCAAAC
GCCCCACTTTGGCGAGTCTTTCAAGATGCTCCAGCACTGCAAGAACCGGAATTTTCCGCTCTCAGCTTCGTACAGCTCCACAGCTTGATGAATGATGTCC
GTTGGAGATCTACCACTAACATCCAGCCGTTCCACCTGCTTGAAGCAACCGACAAACTTCGACACAGACCGCGAAATTGTCTGGAAGCGCGACTTCAGCG
AGCCAGGATTTCTCGTAGTAGGAGTCCCTAGAATTTCTCAAACACCTTTCTCACCTTGTGATACATGTCGTCTCCGGTCTGATTGATCCCAGTTGCAGGA
TCACAGCTAGCATTCAGCCATGCCTCACACAAAGCCTTATCATCTGCAGCACTGTAGTTCGCTCCTCGTTTCTCGGACATTTGCAGACTGTTCACCACTC
CGCTGGTGCTATTTTCAGAGACAAATTTAGCTCTAGATGTGGCCCCGATGGCCTCAAAGCTAAATCTGTTTAGCTTTTAGCCGCCCCGGTGGCGCTGTGC
AATGCTATCCTAGTGCCAAATCTGGCATTTTGGGCGCTAATAGCACCCCGGTGTGGTCACTCTTAGTGCAACA