Description :
From Genome Similarity Track
Location :
contig_77:115027- 120087
Transcript NameFunction/comments
g10126.t1hypothetical protein
g10127.t1hypothetical protein
g10128.t1PREDICTED: copia proteinlike putative

Sequence
5060 bases(100 bases per row)
TGTCTCACGCGCTTGCCGGTCTGAGTTTCAGCAAACGCCACAAACTCCGCGAACTTGGCAGCCACCTCGGACTTGTTCCTCAGCAAGTACACGACGCAGA
AGTGCGACTTGTCGTCGATGAACGTGACGAAGTAGCGCTTGCCCCCAAACGTTGGCGTCTGCATGGGGCCGCACACATCGCTGTGAACCACCTCCAGCAC
GTGCTTCGCACGGTTCGGGGACGACTTCATGTAGCTCACTCGCGTTTGCTTGCCGAGTGCACACCCGTCGCACAGCTCCCACTGCTTCACCGACGTCATG
TCGATGCCAACACCGTAGCTCTTCTTGACGATGGCGTCTAGACCGCCATGGCCAATGTGACCAAGTCGGAGGTGCCAGAGGTACGACGTGGTGTCCCCTT
GGCGATCCTTCGAACTTGCCGCATTGGCCTCGTCAGGCATCATCGGAGTCATGCACAGCTTGAACAGCCCTTTGCCCTCACGAGCGCCGAGCTGCCACTT
GAGACCCTTGTTGTCCGCGAAGCACCCGTCGCTCTCGAAGGTCACTGGCCCGACGTCCTTGGTGAAGCGGCCGACCGAAAACAGGTTGCGCGACAGCTTC
GGGATATGCCACACATTCGTGAGCACACCCTTCTTCATGCCGCGCGGCGTCTTCATCGACATGACAATGTCGCCGGTCCCCACCGCCTGAACCACACCGT
CGTCCGCGAGATGCACGTCCACCGGAGCCATCGTCTTGTAGTTCCTCATGTACTTGGAACTCGTCATGTGCTGCGTCGCACCCGAGTCGACCAGCCACAT
GTCACTCGGCTTGGCGGTACTGCTCGTACGACCAACCGAGAAAAGGTAGTCGCCAGGATCTTCTTCGTCCTGCGCGACGTTCGCACGCTGCGACCGATAT
CGCTCAGCGTCGTTTGGACCCGCGAGGACACTCCGCGATCCAATGTCCTTGTTTGCCGCAGTTGTGGCACGCCGGTCTTCTTCACCGGTCGGCCCTTGCG
CTTGTTGTCTCTCGTCATGAACGCTTGACCTTGGCCGTGCGCGGCTCCGTCGACGCCGCCACAAAAGGCTTTGGTCGGTTGATGGCAAAATGCAAAGTGA
TTGATTTAGGTCCTTAGTTCGCAAACTCCCTTGCTACCTCTAAGCCTACTGGATTCTCTACTGGATACACTCTACTGGATTCCTTACCGGATACTGAGTT
GCTTCAGCCAGTCAGCGACTGCCACGTGGATGCCCATCTTGTACCCACAATCTTGTACCCACGTGTCCCGTAATCTCCGTAGCGTAAACAGCGTCCCATC
ATCAGTGTCCCGCGTCCCATCATCAGCGTCCCGTCAACACAGGAATGATTGCGGTCCCACTAAGTGAAGGTCATACCGGTATCCTACCGGTATACGGCAG
CTGCCCGAGGCGCCTTCTTGACAACAAGCAGCAACGACGAGCTGTTGGAATTGACCAAGCACGCGTTGAGCAAGCGGTTTGAGATGACGGACCTCGGCGA
GCTGGAGTATTTCCTCGGGATGGAGATCAAGAACGACCACGGCTCCGGAAAAGTGACGGTGCGGCAGACCAAGTTTCTCAAGTCCATCCTGACCAAGTTC
GGCATGCAAGACAGCAAGCCTGTGAAGACGCCGCAAGACCCCGGACTCAAGCTGACCAAGAACATGTGTGAGGGTGGCTGCCAGCATGAAGACATGATGA
AGAACGTGCCGTATCGGAGTGCCGTCGGTGCTCTCGTGTACTTGATGGTGGCAACGCGTCCGGACCTCGCTGCTGCAGTGGGAGTGCTGAGCCAGTTCTC
TGCCGACCCGTGTCCGACGCATTGGCAAGCCCTCAAGCGTGTGCTGCGGTACCTCCAAGCGACGCCTACGCATGGACTCGAGTTCTCACGGGAAGACAGC
CTTGGTATGTGCGGATATTCGGATGCGGACTGGGCCGGCGACATCGAGTCAAGACGGAGCACAAGCGGCTACGCGTTCATGATGAACGGCGGATGCATCA
GCTGGAGGAGCAAGAAGCAGCGGACGGTGCGCTGTCTTCAACGGAGGCAGAGTACATGGGCTATCGGAGGCAACACAAGAGGCAGTGTGGCTCAAGGTGT
TCCTGTGCGAGCTCGGCGAGATGGCAAGCGATGAAGCGGTCAAGATCTACGAGGACAACCAAGGCCCCATCGCGTTGGCCAAGAACCCGCAGTTCCACAA
GCGCACCAAGCACATCGACATTCGCTACCACTTCGTGCGCGAGAAGGTGGAAGACGGTCAAGTGGTGCTGCAGTATGTTTCGACAACCGACATGCTGGCG
GACATGATGACGAAGGCGATCACTGCGGTGCAGTTCAGTGTGCTTCGGAGCAAGCTCGGGATCCAAGTGCAATCGCTGTCGAGTCGAGTGGGAGTGTTGT
CAAGAAGGCGCCTCGGGCAGCTGCGGGATACCGGTAGGATACCAGTATGACCTTCACTCAGTGGGACCGCAATCATTCCTGTGTTGACGGGACACTGATG
ATGGGACGCGGGACACTGATGATGGGACGCGGGACACTGATGATGGGACGCTGTTTACGCTACGGGGATTACGGGACACGTGGGTACAAGATTGTGGGTA
CAAGATGGGATCCACGTGGCAGTCGCTGATTGGCTGAAGCAACTCAGTATCCGGTAAGGAATCCAGTAGAGTGTATCCAGTAGAGAATCCAGTAGGCTTA
GAGGTAGCAACGGAGTTTGCGAACTAAGGACCTAAATCAATCACTTTGCATTTTGCCATCAAGCGACCAAGCCTTTTTTGACTGCCTGGAATTGGTGAAG
GCCATCTACGGTCTCAAGCAAGCTTCGCGCGTGTGGAACGAGACCTATGACGAGTTCATGTGCTCTATCAGTTTCCAAGTGTCGGCCTTCGATCCGTGCC
TCTACATCAAGGTGGTGGACGGTCAGTGCGTGCTCGTGCTGGTGTACGTGGACGACGTGCTGATTACCGGGAGTTCACACGAGCTGATCGCACGGACGAA
GACGGACCTGAAGACGCGCTTCGAGATGACCGACAGCGGCAAGTGCGCGTTTGTTCTTGGGATCGAGCTGGTGGACGGCCCGGACGGCAGCGTGACCATG
TGCCAGCGTCGCTACGTGGACGACATCCTGAAACGCTTCGCCATGGACGAGTGCAAGGCTGTGGTGAGTCCGGTGGACATGAGCACTCGACTGGTTCCAA
GCGACGCGGCGACCAAGGTGAACGCTCCGTTTCGCGAAGCTGTTGGTGCGCTGATGCACCTGATGACCGCCACGCGCCGGACATCGCGTACGCCGTTGGC
TATGTGTCGCGCTTCATGGAGAACCCCAAGAGGAACACTGGGTTGCGGTCAAGCGCATCTTTCGCTACCTGCAAGGCACCAAGACGCATGGCATCTGCTT
CAAGCTGGGCGACAAATCGACTTTCGTGGCTACTCGGACGCGGACTGGGCCGGCGACCTCGCGGACCGCAAGTCCACTTCAGGCTACGCGTTCATGCTGA
TGAGTGCGCCTGTGAGCTGGGGAAGCAAGAACAGTCAAGCGTGTCGCTGTCCACGAGCGAAGCGGAGTACATCGCGCTCAGTCTGGCTATCCAAGAAGGC
AGTGGATCCAAGTGGATCCATCGCCTGCTGTGCGAGATTCTGGCGGCTGCCAACGAGACGGGACCCGAGCTCATGATCCGCGAAGACAACCAGTCGTGCA
TCAAGATGACCAAGAACCCGGTGAACCACGGCCGCGCCAAGCACATCGACATCAAGTACCACCACATCCGCGACGAAGTGAAACGCGGTGAAGTGAAGCT
CGAGTATTGCGAGACTTCTGTGATGCTGGCGGACATCATGACCAAGGCACTTGCGGGACCACGCCACACGGAGCTGACGGCGGCTCTCGGCATTCATGGG
ACTTCGCATTGAGGGGCGTATGAGGTATGGAGGGTTACCGGTTTGGTATCGGTTGTTGGCCGTGAACCGGTTAACCCGAACCGGTCCAATCCGAACCACG
CCGATTACGCCACCGACGATTACGCCACTGTCGATTACGCCACCTGTGGTACAAGATTGTAGTACAAGATGGGCTTCGACGTGGCGCTCTCTCATTGGCT
GAAGTAACCAGTATCCAGTAAAGAATCAAGTAGTGTGTATCCAGTAGGTCTAGAGTAGCGAGAAGGCTAGCGAGCTAAAAGACCTCAATCAATCACTTTC
GAATCTTCGTTCTACCCCTCAAGTGGTTTCCAGTCTCCGCTCCGGTTTCGCCCAGAGTGCTGCCCTCCCTCCGCTCCGTCAAGCTTCACGGTGTCAAGAT
CCATACCTTCCATCAGTCGCCCGGCTTGAAGCAGATGCCATGCGTCTTGGTGCCTTGCAGGTAGCGAAAGATGCGCTTGACCGCAACCCAGTGTCCTCTT
GGGGGTTCTCCATGAAGCGCGACACATAGCCAACGGCGTACGCGATGTCCGGGCGCGTGGCGGTCATCAGGTGCATCAGCGCACCAACAGCTTCGCGAAA
ACGGAGCGTTCACCTTGGTCGCCGCGTCGCTTGGAACCATCGAGTGCTCATGTCCACCGGACTCACCACAGCCTTGCACTCGTCCATGGCGAAGCGTTTC
AGGATGTCGTCCACGTAGCGACGCTGGCACATGGTCACGCTGCCGTCCGGGCCGTCCACCAGCTCGATCCCAAGAACAAACGCGCACTTGCCGCTGTCGG
TCATCTCGAAGCGCGTCTTCAGGTCCGTCTTCGTGCGCGAGATCAGCTCGGGCGAACTCCCGGTAATCAGCACGTCGTCCACGTACACCAGCACGAGCAC
GCAGTGACCGTTCACCACCTTGATGTAGAGGCACGGATCGAAGGCCGACACTTGGAAGCCGATAGAGCACATGAACTCGTCGAAGGTCTCGTTCCACACG
CGCGAAGCTTGCTTGAGACCGTAGATGGCCTTCACCAGTTCGAGGCAGTCAAAGTCACCATCCAGTTCGACGCCTTCGGGAACCACGCAGAACACCACCT
CCTTCATGACCCCGTACAGGAACGCTGTCACGACGTCGAGTTGGTCGAGGGGCCAGCCGA