Description :
From Genome Similarity Track
Location :
Scaffold_44:115025- 116903
Transcript NameFunction/comments
Hyaar_Emoy2805937myosin-like protein
Hyaar_Emoy2805938myosin-like protein

Sequence
1878 bases(100 bases per row)
TTCCACCAAACCAAGACAACGTACTTGCTCCGCCACAAGCTCTTTGTTCACAGCTAACGGACGCTTGTCCTCGTTTGGCTTGATGCAACGAATGTAGTGC
GGGTTGCAGCCATCCAGCTTTTTCAGCAAATCCGCGACTTGAGTTCGAAACTGTTGCGAAGTCGAAGGCGGGCGTTTCAGCGTTTGCTCCTTCGTGCGCG
TATCGAGAGACACTTCACGGACAAAGGCGTTCGACGACTGTTCCATGCCGTCTTGCAGGTCGTTAAAGAACGTGTCCACGTTGGCATCAAAGAAGAGCGT
GACGTCGTACTCGACCTTGCCAGCATAGTGCACGATACCGAAGTTGGGCCCACGTACGCGAGACGCAACGTAATGCGGGTTCTTCGAGTGCTCGCAGTTG
TACCGTTCGATAAGCTCAAGATCGGACAAGCGCGCAATAGCACACTGCTCGTCCAGCAGTGGGAAGATACCGTGCTGTTTGGGATCCTCAATCAGGTCGC
ACACTACCTGATTATTGAAAAATGTAATGTTTTGCCAGCTCAGGCCTTCGCGATGGTACCCTTCTTGTTCACTCTCCAGCGTCTGACTAATAAACAGCTG
CTGCAGTTTCTCGTTCACATAATTGATGCACAGCTGCTCGAATGCATTCACTTCAAAGATCTCGAACCCATAAATGTCCAGGATACCGATGCTGTTGTTA
ATGTCGCGCTTCTTGCACGTCACGTTCTTGTTAATCCGAGCCACAATCCAGTCGAAAATCTTCTCATAGAGCGAGCGCATGATCGAGTCACACACTTTTT
TCGCCTGTCGCGCATCAAACAACACTTTCTGATCTTCTCGGTAAATATTCACAATGCGAAACGTCAGCATCGCCTCGAGTTTGTCCTTGTCAATCCCCAT
CAACCCCGCCGCCTTGACCAACGCCGCTCGTGCTTCCACCGTTTCAATAGCCGCACAAGGATTGTGCGCTTCATCGGCCGTCTGCTTGAACCGCACGTTC
CCGAGCCACAAAATCGCCGACAGTTGCTGGAAAATCTCGTGCTGCTCGCCGTTCGTAATACCGACCGCCAGCATATTTTTCCGGACCATGCGAAAGTTCG
CAGCATCGTCTACGCCTTCAATCGTCGCGGCTTCATTGCCCAGGACGTCAAAAGCCTCGGCACTCGGTGGCAATTGCCACGCCTCTCGTTCGTCGGTTGT
CGCCCCGGCTAAAAGCTGGTAAAAAGCGTGGAAATTCCGCTCGCCGGCTGCTTGACGGATCACGCGACTCCGCTCGAGCAAGTAATTGTCAATGTAGCCA
CCAATGACTTGCCCCACGCGGTTCATCTGGAGCACAATGTACTTGCCAAAGCGGCTGCTGTTGTTGTTCCGGATCGTCTGCGCGTTGCCAAAGGCCTCGA
GCACGGGGTTACTGCCCCAGAGCACGTCCGTCACGTGGCTCGTCATCTCGTCCGCTTCTTTGCGCTGGGCCATCGACATGCGACGACTGGCCACGACAGC
GCTCTTGGCTCGGAACCGCGTGCTGATGGTCGTCAAGTACCGCATCACGTGCTTGGACGTCTCGGTCTTGCCGCTCCCGGACTCGCCCGTGATGAGGAGA
CTCTGGTCCAAGCCGAAGCGCATGAGACTCGTATAGGCGTTTTCCGCCAGAGCGAAAGGGTGCGGATCGCACAGATGAAGCTCTTTACCCTGGAACTGGT
CGATCATGTTGCGGTCGTAGATCGAGTCCCCGTTGGGCTGCAACAGCGTCTTGTACGGGTTCAGAGCGATGAGCACGGGGCCCAGGAACGTGTAGACGTA
GCCCTGACGGTACCGCGTCACGAGTTCATTGACGACGTGGGCCTCGTCCACGGCGTCGACCATGAGGAGGTCCTTCAT