Description :
From Genome Similarity Track
Location :
Scaffold_29:11502- 16153
Transcript NameFunction/comments
g7665.t1XP_009527295.1 hypothetical protein PHYSODRAFT_501714 [Phytophthora sojae

Sequence
4651 bases(100 bases per row)
GCATCATCCACAAGTGCCATATTGTTAATTGTAACAGTTGACTTGGTGCAGACATCACTCACGCTGACCATGCTCCGTCGACGCACTTCCCGACTTTTGG
CACGGTTGCAGCAAGCTACCGACACAAAGGCAACACTGTTGGATGTCATATGTCTCTTAATTCGCAACCCACAAAGTTTAGGGACGCAGGCAAGAGGAAG
TTTCCGTCGCCATTCATGTATTCCTCACCGATTGCCTAGAGCTTACAGTGATTTGATATCGGACTTAGGTCTCTCACTGGAAAAAGCTCCAGTGAAACCC
AGCAGCAAACATGCTGGAAATACGATTGTGCCTGAAACTGCAGCACTGCAAGTGGCAAGTGCTGCCCAAAGGGAAGGAGCTTTACGTCCTCCTTACCCAC
AGTTAAAAACGGTTGAAAGAACTCTGGAAACTCTCTTCACATCGGAATTTGTCATCTTGACCGAGTACTTGGAGGCATTTATACCAACGTTCAGTGGGTT
CTTCGTGCTGATTCTGGTGCATCTTCCAACTGCGCAATATCACATCGAACTGGAAGACATCACGCCAGCAAACGTGTATACTACGATTCAAAATGTCTTT
CTCTACGCGCTGTTGGAAGTCGCATCACTTTTGGTGCTTGTGGTCGGGATGAAGCGCAGTTGCAGAATGGACGTGCTTCGCCACCTATCGTTTGTCTTGG
AGACCCAAATGCCATTAATTCAATCTAAAATGCTCATATGGATGTTATTTACAATGAGTTTTCGCGTGGTTCACTTCGGTACGTTTTGCTTTCACTTTGC
ATTGACAGCTTACTAAATCTCCTTTCAAGTCCTGCAATACTAACGTAGCATTGTGTGTGCTGATGCCGAAGGTATTGACTTCACGTTTAGATTTTCATGG
ATAAACAAAACCTGAAATGCTCTGAGGCTGAGACTGCATATAAAACCAACAAGAGGAGGAGATTCATCTGTCAATCGAATGCTGGTCGCTACCTTCTGCA
AATGCTGGCTCCTATCTCGGGTATACTACCTTGCAGCCCAGACACTACACAATACTTGTGGTATCAGAAATTTGTCCAGCGTGCCAATCACGACGGTGTG
CCTCTGTGTCAAGGATTAAATGGGTAAAGAAAGTTGCTAGTATTTGGTTCTCGATGCACGGATATTCCGTCGAGTGTCTTTGACACTGCACGTAGAATGT
ATATAATCAAAATGCTTCATGGCATTGAGTAGCTCTCGGAACGCCACTACCGATGATCATTTTCGTGCTGTCACTGGAGTGCGTACCACTTCAACAACCC
AGCGATGGATGGCAAGCTGACCACGGAATCTGGATCAACTATTTTGAGTGGTGTGGTTGACTACACGCTTCTCACCCAGGTAGTATGTCTGATCCAGGAC
ACCTCGATATCGTCACGCTGCAATTCTAAAGAGAAATAACTTTCATTACACTGTTGGAACAAGAACGTCCCATCCAGCCCCGATTTGGTCGAGTAACGGC
CCTCATAGTCTGCTTTTAACCATGTTGATTTCTCATCTGGAGGCGATCAAGGTTGAGTCTAACTTTTGCTCGGAACATTTGCTCAGCAGTGAATTCGATC
GATAACATGAGTACCTGTGTTGTGCCATTTGCCCCAGGCCCAAGCCGCCGTGCCAGTACCTCCTCGTGGTCACAATTTCTAGGCGTCTATCTGGTTCATG
GGATTTCGGCAGTCAAACGCTTTTGGGTTGCAACACAAGTGAGCCACCGTGGAAAGTACTCCATCGAGCGCCTGCTTGCGCTCGAGGAATATACGCGAAA
TACATCTTTGATCCGAGTCCTGCTCGTGTGCGCAGGGACACCGCTGCCAATTATCATTTTGATTATTTCGCAGGAAGCATTACCACTGGAAAGCCCTGCG
GCTGGGTGGAGAGCCAACTGGGGATTTTGGATTCGGACCAGTCTCTTAGGAGGAATGACCTCTCTTGCCATTTTTTCTCAGCTGAGGAATCTCATCAGCA
GCGTCGAAGTATCTGTGAACCAACTTATAATCCAGTTCGTCTTCATGGCGATAAGCTACACCGCTGTATCTATCCTGGTCGCCGCACTGTTGGTATTTCC
AATCCCTTACATGGTGATTGTGATGGCATCTCCTTTTCTTGTGCTGCTAGTGGGATCGATGCGTGCTATCCTTGGCGATCGCGTCTTTCGCAGTATATTA
GAAAATCGACACGAGCTACAGCGCTTCGCCAACACAGTCTCCGTCCAGGTGTTGATGGCGGTGGTATACCCAGCGTTCCAGGTGTTCTTCAACTCTGTGG
CAGGTTCCCTCTACGAACTGCCGGCGTTCATGCTGCTACCCGTCATAAAGTTTGTGCTGAAGCATCTTGTCGCATTCAGCCTGGCAGATTTACCCGAGCT
GATCCCCCACCACATCATTTTCACTGTCCATTTTTTCAATGCTCTGTACTTGGCGACGTGCATGCAATCGGCTAGTTCACTTTTGGCTGTAGCAGTAATT
ATGACAATTGATTTTTTGGAAACGGGCTTCGCGCTTCTCGGCATCTACCGTTCAACCATCTGCACAATGAAACAACTTCACCAAACCATCGGCCCTACCA
GTACAACAGCCACACTACTAGATGCTGCGTTCTCGCTATGTCACTACCATGACAAGTTCACGAAGGAGGAACACAATCAAATTCAAGTGCACTCAATGCT
CCGCCATCAGCTGTCACTGAATTCAAGAGATATTCTCGCCAAAATTGACAACAGCGCCCTCAACTCTGGGCCAACCTTTCACCGTGCATCCAACACGCAA
TCGATGCCAACGATGAAGACTGCCGCTGTTGCTACTTCAGATCCATCGCGCTTGCGAGCGGTATTCAGCCATCAGTGGGGTGCGAAAATCGATCCAATCA
TGCCGATAAAAGCTATTCACGTGAAAAAGTTGGTGCACGCCGAGCATACCCGTAATCTACAAGCCGTGGCGGCCGTGCCGTCAGTATTGCACCTGACCAC
TCTTCGGAAATCACTTGCAACATTGTTCACCATTGAGTGTATGGTGCTGGCAGAGTACGTCGAGTTCGTCATTCCTTTGCTGTATGGCAACTATGTTCTC
ATGATGGTACGCCTCCCGAGTGCTAAATACCACACTGAGCTGACTGGTATGACTCTGGAAAACGTCGGATCAACCGTGCGAACCGTTTTCATCTACGCGA
TGCTGGAACTTGGGTCATTTGTGCTGCTGGTCATTCTGATGAAACGAAGCTGTGGCATGCAAGCTCTTTACCACCTCGCGTTTGTGCTTGAAAATGAAGT
GCTCTCAATCCAAAGTAAAATGATCGGCTGGATGCTGATGACGCTGGGCTTTCGAATTGTACACTTCGGTACGTTCACAGAGAGGTTGCCTAGATTGTCA
CGGAAACTCACATTCTTGTACTGTGCACGTTTGTGGCTGCAGGAGTTGACTTCACCTTCCAGTTTTCTTGGATTCACGACCAGCACAGATAGACACACCG
CTCTAAATCTGGGAGCCGCAATTGACTGTTTTGTGCGGAAATGCGACGAAACGTATACAGCTACAATTGGCTTGTCCTTCCGACTGCAGAAACATCGATA
GCTGCGCCACACAAGTTGCCAGGCGTCTTCGGGGAGTACTCCGCACCGTTCCCCCAAATCGTGACACTTCTGCTTCGACTGGAGCGCAGGTGGGGAGATG
ACTTTGAGGGATAACCGAACGCGAACTCGCAACTATTCGATCGTGGTGATAACTGCGGGGAAGCGAATACAGCCATGGGTAATAAAGCTCAAGCAAATCT
GGTTTGCCATGCAAATCAGCCATCGTGGGAAATACTCCATCGAGAGAATGATAGCGCTTGACGAGTATACGCGGACCACATCGTTACTTCGGGTGCTGTT
GGTGTGTTTCAGTACTCCACTACCGATGATCACGTTCGTTTCCGTAGTCGAAATGATTCCACTGCAGAACCCCAGCGATGGATGGCGCGCCAATTATGGT
ATCTGGATTCGTATTGCTATTCAAGCCGGTGCTGTCGCCATTACAGCGGCCGGCCAAGCGAAACATATACTCGACTGTGTTCAATTCTCCGTGAATCAGC
TTGTCATACTTTTTATCAGCGTAGCAGTGGGCTACACCAGCACGGCGATTGCTGTTGCTGCGGGCCTCGGCTTTCCGATTCCTTTCACTGCCGTGACACT
GAGCGCCGTTTTCTTCGCGCAACTTGGTTTTTGCTTTTTCATTGTCCTTGGCAAGGCCACTTTCCTAGAAATCTGGACACAGCGCAAAAACCTCTTGTGC
TTTCTTGGCTTTCTCTCTGCGCAAGTGACGCTGGTCCTCGTGTATCCATTTTACCAAGTGCTGTTCCAGGCAGCATCCGAGAATATGAACTACGAGCTCG
CTGCGTTACTCCTGCTCCCCATCATCAAGAGTGCCATGAAGAACATCGTGTCCTTCACCATATCTCGAATGGAAGACATGGTCCCCGAGGCCGTCATCTT
CACCGTCGATTTCTTCAACGCAGTGTACCTGGCCACTTGCTTGCAGCAAGCTACTTCGACCATCACTATCGCGACCATCATGGCGGTGGACCTCTTCCAG
ACAACCGTCGCTCTGCGTCATCTCTACCGACGCACCGACGCCATCCTACAC