Description :
From Genome Similarity Track
Location :
Scaffold_1127:1150- 3535
Sequence
2385 bases(100 bases per row)
TAATGCAGAAGCGCTCACCAAAGTTTGCGGCTGTGCCAACCATACCCTCACCAACTTCTCTTTCCCAGTAGGTCCGCAAGGGACCGCGTCTAGGCTCGAC
TGCCATCGCAAGCCGAACTCCCAGAAAGCGAAACAAATCTCCCTCAGCAATTGGACGTTGCTTACGCTCCACCAACTTGGCATTTGTGTGCTGTAGAGTA
GTTTGTATGGTCGACCACGGGTACATCAGAAAAAAATATTTGGCGAAGGTCTTTTCTCCTAACTCCAGCGTCGCCGGCCAGCGAAATTTTTTTTGCGCTT
GCGTTGCAAAGTTGCAGGGTCGACAAGGAGGTCGGAGCAAAATTCCCAGATGCGGTTGTGGGCAAGTATTTTTCCGTCGTTAGAAATTCCAGAGACCATC
GTAGACTTATCATCTGCGTTATCTTCTTCATCTTCCTCCTCGTCTGAAGAGGATTCCGACTCAGAAGAAGACGAGTCACCCGGACCAGGCCCCGCACCAG
CACCAGCTAACAGCAAAGCGATCATCGACTCTAAAGGCTCCGTAGTCGGGTTCTGCATGGCTGAGTCGCTGCTGGGAGCCTGTAGTAGCTGTATTGAACG
CGCCGACACTGACTGTACTGATCCATCGCCCCACTGAACGCTGTACCACGGCTGGCGTTTGCTGTTGTCGATCGACAGGACAACGCCCTCCTTGCCCAGT
GTCCCCTTAGACTTTCCTTGAACACGATTTCCCACACCGAGTTTCACCATGAAGACAGCTTCGTTTGTGACCGGAAAAAAAGCGCTAAATAGCTCAGACC
TTCCTCTCTATTTTTAAACGATACATTGTGCTTTTCAGTTGTTTTGTCAAATCGGACGTGTAAAACAGCTACCTACTAAGATGGGGCTAGGTTATCGGAG
TAGATTTGTGACGGGGCACACAGCACTTCATAACAGAGGAAGCAGGAGTATACAAACTCCAAGTGAACAGCCGTTCACGTGTCCCTGGTCTGAAGGGGAC
GACTTGACTTGAAAAGCGGTAGATCTAAGACTGAATGTATTTATAGGTTGGTACAGATTTGGCCTGCATACAAATCCTAAGTTCCCTATAGTTTGTGTCA
TACAAAATGTATCTGTTGGCTCTGAGGCCACTTGGGTCACTATCCAGGGGAGTGACCGATGTAGCCATCCCGGAATAGTGACAGGGTCACTATTCCATGT
AACCCCGTTACATCCTCCCCCACTTAGATTCGATCTTATCGACCAATCAGAGCGAGGTTACGCCGGCGACTCACATTTCACTCGCAAAGTCGAGATCCAT
CGACAACGGCGCGAGCTCTGGCGCCTCGGCTCCCGGGCCTCACAGAGCAACTGGCGCATCGCCGAGCAAGCCGCAGGGTCTCCACGTCGACCGGAAGCAT
GCCTCCAAAGCGCAGTGCGCGCAGTGCGAAAGCACCTCCGAAACCGCGGGCCGTAGGGCCGAAGACCAGGGCGGCCAAGGCCAAGGACGAGTCGTCCGCG
CTGATGGAGGCCACGAAGGCGGCCGAGGAGGTGGTGCGCTCTCGTAGCAGCACGCCGGAGAGTGGCCGTCAGGCCGGGGCTCGGAGCAAGTCTCCTGACG
CCGCTCAAGGCAAGGAGGAGAGTCCTCGGGGCCATAAAAGCCCGGCTCGCGACTGGGAAGCCGCCGTCTTTGACTGCACGATGGTCCAGTACTCCGGTGA
GAGTTCACCCGACGACGAGAACGTCTCGGAGGGCAGCACGCACGCTGCCGAAGGCACGGAGCTGGAGGCAGGCGACATGACTAACGCCTCGGCCGACGCA
AAGGCCTCGTCAGAGAAGGAGGCGGAGGACGCCGAGTCCGGCTCAGGCGACAGCAAGCCGTCGCACGACGAAGTCGCCATGGCCGACGCTGGGGTCGTGG
CCGAGAAGTCGCCGAGCGACGCGGGCTCCAAGCCCAATGAGGTGCTGGCATCCAAGCATCTGACGCTGGCACAAGGTCGTGAGCGTGCCCAAGCGTCGAA
AGCGGCTACTGCTGCGAAGACCGCCGAGGCCAAGGCGAAGAAGCGTTCAGCTTCCAGGTCGCCTCGCGGCTCCAGCTCCAAGCTGTTCATCGACTCGGAG
TCTGAGGACGAGGAGGGTGCCGTCCACAAGCCCAAGGAGCTCTCCATCAACCTCGACGAGCAGCAGCAGCAATACCACGCTGCTAGCTCGGGTGTGTATG
CCAGGCAGCCGACTGCCACGACTGCCACGACTGCCATCGAGTCTTCTTCAGGTGGGGATGCCACGTACCCGCAGGGCTACTTCCCGCCCGAGCCTGGCAC
TGGTGCGCCAGCGCTGTTGGAGAAGCTCTCGGCTCCTCGTGGCCTTATCGGCGGGTACACCTCGAGGGGTTCCTATGAGCGTGCT