Description :
From Genome Similarity Track
Location :
Scaffold_1943:1150- 2424
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1943-snap-gene-0.1ATP-binding Cassette (ABC) superfamily

Sequence
1274 bases(100 bases per row)
ACATCACGAACCGCATGCGGTCCATGACGTTTGCGTCGATGCTCAAGCAGGACATGAAGTGGTTTGATGCGCCTGGCCACTCAGCAGGAGCACTCTCTGC
GATGCTCTCGAACGACACAGCAGCCGTCAAGATCATCGCCGGCGAGATCCAGGGCCGCAAGATTCAGAACATTATCGTGATCGTGTTCGCGACGGTCTTG
GCGTTCATCGTCGGTAGCTGGCAAGCGACGCTCGTATTTCTTGCCGCAATCCCGTTCATTATCGCGACCATCATGATCGACCAGCGTACATCGTGGTACA
CTGAGGAAGAAGGAGATCGGTCGCTCGCGACAGCAGGACGCATCGCCAACGAGATCATCCACAACGTGCAAACGATCACGGAGAACAACCTGCAGGAAAC
CGTGCTTGTCGAGTACCGGAAGTCGCTCGACTTGCCGACCCGCGTGACGATCAAGACAGGGTACTCAACGGGTTTTGCGCTTGGCTTCAGTCAGTTCATC
AAGTGGGTCGCATACGCGGCACTCCACTACTTCAGCGCGTTCTTCATCCGAGACGGGTCGACCACGTTCGCGCTGTTTTATCGCACGATGAACTTGATGA
ACGTCGCGGCGCTTTGCATTGACGAGACAGCGACGTTTATCGGCGACGAGAAGTCGGCCAACATTGCCGCGGGGCGTATTTTCACGCTCATCGAGAACAA
ACCCGATGTCGACGTGGACGCGTTAGGCGAGAAGCTCGACGACCAATTCTCCGGTGCCATCGACGTCGCGAGCACCGAATTCGCGTACCCACTGAACCCG
GACGCCCATGTGCTCACGAACTACAACCTCAGCGTGAGTGGTGGCAAGACGACGGTGCTCATGGGCGGAAGCGATGCTGGCAAATCGACGCTTATGCAAT
TGCTGCTCCGTCTGTATGACGTGACTGACGGTAGTATTGAGGTTGGTGGGACTCCGATCCAGCGCCTGGACGTGCGGTGGCTTCGCTCCAAGGTCGCGTT
AGTGAGTCAAGATCCGATGCTCTTCCGCATGTCAGTATTGGAGAATATCCGACTCGGACGCCCCGATGCGACGCTCGACGAAGTGATCCGAGTGTGCAAG
ATGGTCGACGCAGATGCATTCGTCCAGGAATTCCCTGATGGCTACGAGACGCTCGTGGACACGGAGAAGTTTTCGCGCGGCCAGAAGCAGCGTATCGCGA
TCGCACGTGCGTTGATATTAAACCCGCGCATACTGCTTCTCGATGACGCGACCAGCGCCCTGGACAAGGACAGT