Description :
From Genome Similarity Track
Location :
Scaffold_1478:115- 4300
Sequence
4185 bases(100 bases per row)
CACTTCGTCTAGTCGGTTCAACGTAACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTCAACACCACATTGATTCCGTAAATTGGCGCTGGCCAAGCTA
TCGGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCG
GGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCACCAAATTTGAATCCCCACAAATCACCAGCCTTTTCAGATCTTGTCCCTTTAGTAGATCCAA
ACCCAGCAGTAGCCCGTTATACTCCGCTTCGTTGACGGTGAGGCCTTCCGCATAAGTGGATCTGGCCCGTACAACTTCCCATCCAGGTAGTCTCCACAGT
ATTGCACTGTACGCCCCGCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGAACATACAGATCCTCGTCTGCCTGTACCGTCGGGATCGGGATCT
GGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGACCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTC
GTCTTCCCCTTTCGAACATTTCACAATCTCCAGCGTCCAAGGCGAGAGTAAAGCTGCCCACTGCCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAGC
CAGGCTAGCGTAGAGTGTCGGGTCAGGATCCGGATGGATCTTCTCACCAGCAGGTTGTAATTCAAATCCAACACGCGCAGGAGCGCGAGTATCGCTTTCT
CCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGTACCAGAGCTGCTGAGAC
TGCCCAGTCGCTGGCATAAACTATTACCGTAGGTTGACGTTCTGGATCGAAATGACGGAGGATAGGCGTGGTCGCGATCCTGTTCCTCAGTTCCACGAAT
GCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTATCCAGATTGGATCCTCTCTCCGTTGGTTCCGGGGTGGAT
CCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCGTACTACGTGGATTCTCTCGTGGATCTGCGATCTCTAGGGCCAGAGCTTGTTGGATTTTGATCCGGAC
AGTCGAAGTGACCATCGCAGCAAAATCTACCTCTCTCAATTCATACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACCGTAGTAGTTCAAA
CTACCCAAGAAGGATTGCATCGCCCGTAACGACTGCGGGAAGGGCAAATCGGCTAGCGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAA
CTCGATGGCCTAAGTAATCCACCTTGCGCATCTCCCAATAGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCAC
TCTTTCGCACAACTGATCCCACGATTTCGCCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACGGACGGGGTTCCAGGATCCCCTGGCTCT
CTTGCCTCAAATGAATCTACTTCCTGTATGATCTTCCCCGGATCCACCCCTTTTGGGTTCCGGTATTCGGGTGAATCCATAGAGAGCGTTATCGATTAGA
CGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTCCACTCGAACAGTCCAGACGGTGTGATGAATGCGGATATCGCGCGAGCTCGAT
CCGTCATAGTAACTACCCAAAAACCGCTGGCCATGTCAAGAGAGCAGTACCAGAGTACTTTATCCAGATCTTCCAACAGCTCATTGATTAGAGGCATCGG
ATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCTATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACTGGGGATGCC
CACGGGGACGTTGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGATAATTTTTCTCGGAACTGAGACGCCACCTTCCTCACCCTCT
GAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTCTC
CCAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGTGGTCAATGGTACC
TCCGGGATCACCGCCATGCCTTCTCCCAGATCCTCGGCGTGTAGATCCCCGCCTTCATGGTAACAGACTTGCTCATCTTCCGTCTTCGTAGGATCCACCA
TTGGATCCAAACACCGCGGCCCTCTTTCGCCTGACAGTCCTTCTGTCTTCGGGGAATCAGGTACCCTGGTATCAGGGAAACCAACAGTTGGATCTAGTCG
GTCCTCTAACGAGATTAAGCCCGACGATACTGGTTTGACTAGTGTTGCCACTCTCGATAAGGATCCAGGCACTTTATCCAATGGAAAGCTTGGATCCACT
TGTGGATCAGCGGGATCCGGCTGTTCGGCTTTAGGGTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCCCCGT
CGTGGATCCAACCTCCATTGCTTGGATCTCAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTT
GGCTCCGCCGGGAGCTCCACCTCTCCGAGGGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACA
CATATCCATGTCGCCTAGGGATACCGTCCTTCGCTAACCATCGCCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTG
GAGGTATCGTGATCGACCTGGTCCCTGGATTACGGTCGGCACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACCTTAACCGATCT
GGCAGTTCCCAGGTTTCCCCGGGCTCGATCCAGGTTGTTTTATCCGCCCTTATGATCCTCATCTTCGCCCCATACAACGGTCGCCGTCCGCTGAGCTGGA
TCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCTAGATCCAACCTCACTCCGGCCGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGC
GAGATCTCCAACCCAAATGTCAAACCAGTACACCAAACAACCTGCCAGCGTGATCTTGATCCGTTCGTGCGGTACACACCTTCACCAATACCAACACAAT
CTTGGATCCGACTCTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTACGAGTAGGATTGCTTTTTCATTGTT
GAACTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTTCCAGTATCCACGGGACTCCCCTGTTAGCAGATCCATGGCTCCAAC
ATCCTCAGATCCACGGGATCCAGTGACCTGACAGACCTAAAGTGGATCGGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGTGTTTC
TCCCAATAACCACGTGCCTCTCGCCTTTGTAGATCCAGGATTGAGGAGACTTCGGATCTGGCAAACTCATCCACTTGGCGCAAACCAGAAATCTTGGCAA
CTGAAACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGAGACGTCTGGTTCACAAATGCATAAATGCAATACTT
AGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGTGTCCTAGTTTAACATCTTCTTGGCCACTTCTGGCAACATCCCTCTGTGCTTGGCTGGATCAA
ACCATTGGCGGATCTGGTTATAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCTCCGGG
ATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAAATTCAGTGTGTTTCCGGGATCCGCACTGTGAACAC