Description :
From Genome Similarity Track
Location :
scaffold_588:115- 2396
Transcript NameFunction/comments
g9381.t1 elongation factor 3, putative

Sequence
2281 bases(100 bases per row)
GTCGGTGTCTGGGCCCAGGTGTATCAAGACCTGCCTCAATTAGGTTTTGGCAGATCCCGCTCCACCACAGTACAAAAGGGCTGTCGGGACAGACGGAGGC
ACTCAGGAACCCACACGATGGCTGGCCACTTAAACGGATAGAAGGCTACCCCCTTGCTTCGCTTCTGAGTACTGCATAATGAGGAAAATGCCTTCCTCTC
ATTGCTTTACTCGTATGTCGCATGACTTGTTGCTGCGCAAGGTGCTCTTCCAGTGGCTGAACTGGCTCCATGTTGCGGATGAAGTACAAGCCGTAGCTTT
TGTGAAAGTGAACGCCAAAAACCAATTTGACTTGTCAGAGTGTCGGAGATCGGAAGTCGGTCTCCGATTTGTTGGAGCCTGGCAGATCCGGCAAATCCAA
TAAACCCGGATTAGATAAAACAAAAACCCTTCTACGAGTGTGATGCATCCGGCCTACGCGCCATCCTCTGATAGACCTCCGCTGCGCTCCGGTTGTCAAG
GCGCCTCTCTAAGGCCTCAAAGTCCAAATTGTACTTTCTTTGGAAATGACCTTGGACGCACATCCTTTGAAATGATCCGTCCCTCACAAATGCTGCAGAT
GTACGGATTCCGAAACAGGAATTATAGCGCCCATGTTTTATGAAAGAGGAGGGTGAAAACCAATTCTGAATTGCCCAGCACCCAAATGAGCACCTGTGGC
TTCAGAGCTGTGTCTGCAGCTCGAAGCCTTTAGCACAGGGCCATGAATGACCTAAACGAGCTCGTTTCAGAGCTGTGTCGGCACTCTCAGGCTTTTAGAT
GGAATATCTACTGTACCGGTAGGCGATAGAATCCTCGATTGATTATGGAGAATTACATCAGATTTGCGGGTCATGGCACCCCTTTGGTGCAAAAGAGCAA
TAAGGACGGGTCCATGTTTTGAACATGATTTAAGCATGTTTTCCATGTTTTAGGTTGTATTCGGTTTTAGAATTGTATTTTAACCTACCCCGGATAGGTC
GCCATTCCGAAAATATGCGTTTGTTTTCGTGATGATTAAACTCTGGATCAGTGGCAACTTATTACAGCCGGGATGGATGTCATGGCCCTCGAATCATCAA
AACTAGCACTGTTGGGGTGACTAAATCCCCTCAGCAAGCGAAAACGACTATTGCGTTCTCGGGTTTAGCCTTTTAGAACAGGTACAAACAATTAGACCTA
GCCAGCGAGTCTAATAGCGCAGGGCGCGCTTGTGTCCATGTAAACGAAGGTGGCAATATGCTTCCATCCAGCCGAGTGTCTGTTCACCCTGTCACTGTAA
TATTTTATGTGACCTGCCGAAACTTATATTTCACAGAAAATGAAAAGAAAATTGCATAGAAAGTGCTATATTTTCTGTTGGAATAGCACGATTCATCTGG
ATCAAAAGATGAACGAATTGACATGTACATGGATTATAAAACATTATGGGTTATCCATTGTTTGGATATTATATGATAGCTGCCGTTGTGGCACATGAAG
AGCGCAACCAGGCCCTAAAGCTACTCACCCTCGCCGCCGGCGAATCGCCTGCACTCGGGCCTATGCAGTGGGCGACAGTGCAACGACCAGCGCGACATGT
TCGACGGCCTTGCCCATCGATCAAGTCAGCTCGTCTCGATGGCGCGACTGCGTCTAATTGGCTGGTGGCGGTTTGTTAAAAAATGGGTTAAAGCACCAAC
CTCTGTCATTTGACATAACGTGTGCGTATTACAATAATTTTTTCTCATTGAACGACATTTATAGCTTCCTATTTCGTCGGCATATACACTATTTTTACTA
CCAACGGACCCTTTTCCGCTTTAACAGTGACGTCGACAGCCGTTACGAAACGGGCGAACTTCAGATTCAGATTTGGCTGGCTGTTGTGACTTGTGACCTA
CTGCCGCGCTGCGTCTCATTCTCGCATCGGCAGCCTTCGCCACCAACCGCCTCGGATCCGCGCACTCCACATTTAATACAGCAGATCACTATGGGCAAGG
GACAGCGAGCACGCAAGGCCGCGGCCGACGCCATGATGGCGGCTGCCATGTCTCAAAGCACGCCGTCCGTGCTGGAACAGGAGTACCACGCGCCGTCGTC
GCTGCAGGTCGTGGCTCCCAAGAGTTCGGGCCTCAATGTAGTCATGCCGACTGTGCACAAGAAGCCGTCGCCGCCTCCCTCCGAGACGTCGGCGTCTTCG
GCGGACGACAACGACGAGTTCCGTGAACTGGCCACGGAGGAGCAGCGCGAGGCGCTCCGAGCTCTTGAGGATGTCGAGGCT