Description :
From Genome Similarity Track
Location :
scaffold_77:11498- 13390
Sequence
1892 bases(100 bases per row)
TGGcgcattgttcacgctttcaACAAATTGAACGATGCGACTATAATTGCTTAGATCCCGGCTTCACGCAAGGATATGATCCTTGAGGGAATggtgggtg
gtgtcgttttctGTGCGGTCGATCTAAATATCAGATGCGACTTTGCGAGACGATGCACCCTACTTGCGGTCAGTACCCCAAGTGGTATTAGATAGAAATG
GGTCGTGATGCCATAAGGTTTCAATAACGCTCCCGGGATTATCAGCAGCATCGTCGACGAATTTTCTTTGTTCATTGAGATAGTTTGTACCGAGTCATTC
TGACGAATATTTGTTCATAGAAAAAACGAGTGATagatgttcatcttgatcatttttgtcaagttttttaAGTTATGCGAGAGAAGTTAATCTAAGCTCG
TATGAAAACCTATCTGCTTTGTCGGCAAGAATGATGTTTGTGTAGGATTGGAGAATGTTAGAGCTGCCAATTAATGGCATGTGTCAAACAATGTGGAACA
GCTGCTTCTATGGCTGGGCTTGGCAAATTATCTGTACAAATACACGCGCAAGTATGCAGCCTTGATGCAACTCCTAACGACTCTTCTAAATTGGAGTGTT
GAGTGGAAATAGTCACTCAGTGTTCTTCCGTAAACAAATTTTAGGGTTGCACCAACGCGTGGGAATGACCAAAAGCTTACCAGGCGGTGTTTTCTTGAGT
GATGAAGAGCTTGCAAGAAGCTTCTTTCTTTGCGATTGCAAACTGCGATCAGCATTTCAGTGTGGTCTGCAATACAAGTGAATATTCCATCAGTTTtgcg
ttgatgcaacacgatggTGAGGGTCGAGAGCGAGCTGTTTCGTATCCGTTGCAACAACACCGGTCCACAAAAATGAATCATCCGCCTCATAATAAAGAGA
GTATACAATAAAGTATGCTTTGGTCAAGTTTCGTGTGTACTTGCTTGGACAGGAGCGCTTTGTAACTCATACAGATCCTGCTTCGCTGCGTACAGAGGTA
ATGACTCCTCATTtatcgcagagaatggcagGATGggttttcttctttgcgaagTATAACGTTGGTCTAAACTCCAGGCCATTCAAGACGAGCGTCTTGG
CTGATGCAGTGTCAAGACATTCGGACTATGATTCGAAGTCCAGGAGAGAAGACAATCACGACCTCTCTCGACAATACAACGATATTCCGGCGAATAGCGT
GAAAGCTACGAACACAGTGCGCGTAGAACTTATCGAAGCGTAAAAGTCTGATAAGTCATGTCAGGAACTGTCAAGGAAATTCAAGTTCACTTCTGACAAA
GCACTGAAACGTCTTCCATCTCGCACAACATCGCGTGCTCATCGTTTTGCGTCATCGTCTTTTATATTAATATCATGACAGCATTATGAATGGAGATCTC
GAACATGAACAAGCGCTTTTCAGTCTTTCCAGGGATTACTTTTGGCCACACATGTATAAGTGGTGTGCGAGTATGTACGGACTCATGAGGTCTGCCAAAG
AATAAAACTATCGAGCTCACACTTCGGTCGTTGGCTGTGTTAGCTGACAGCTTGAAGTCTGTAAGTATAGATTCCATTTTCGGACGTCCACGTGACATAC
ATAGACTCAATGTCATCCTTGTGTTGCAGAACCGAATCAGCAAGATATTTCATCTTGCGCCTATTTTGTATGATACATCCACCAAAAAAACAGCTAGAGT
CGTTGTATACACTTTTATTTTCTCCTTGCATTCCTCTTAAGATCGTGTCTGACCGTGACACCCGTTTCACGTCGAAGTTTTAGTGTACACTTTTGGACTA
TTAAGCTCTAAATtgtccatgtcaacagcggcacaCCCTAAAACAAAAGGTCAAACAGAACTTAGATCGAATCCTGGAGGACGTACTGCGTA