Description :
From Genome Similarity Track
Location :
contig_57:114944- 116488
Transcript NameFunction/comments
g10954.t1hypothetical protein

Sequence
1544 bases(100 bases per row)
GTCGCGCTAATTTTCGACAGACTCTAATAACCCTGATAAGGAAATAGTGTCGAGGACAGTATTTTCCGACAACAAGAAATTAGTGTCCAATCAGCGACAG
GGATGTGACGTTGGTGCAGCTTAGTGGTTGAGCGCTCGTTTACCAAACGAGAGGTCGATGGTTCGATTCCATCCACCAACATTTGATTCGGATCATGATG
CGGATCATACTGGGGTTTCTTGTTCACATCGAGAGCCGGCGCACAGAACTGCTAACGCGACCGCCGTCCGGCATTTCGTGTGAACAGGTTGACCGCCAGT
ATGCTAAGCACCATGAGTCGGGCGCCCCTTCTGACGAAGATTCGATGCTCGTTCTGATATCTCAGAACACTGCGTCTACAATCGGAAGTCACAGCGGCCC
CAGGCATACAGAGGGATATCGTATCACAACTCCAAGACTAGGATGTAAGCAAGAATGAAATTTTATGAAGTTGATGGAGTGTTGTCCTTTCTTGCGAACT
CATCGGGGTACTCCTTGATGATTTATTGAAGGTGGGGGTACAGCTGTGCCACAGTCCAACTCCCATCAACGTCTCGGGACATACCGCAGCGAATCATAGC
CTTCCGAGCATACGTCAGCCCGTTCTTGTCTCTGAGGGTGTTGAGCTCTTGCACACACTCAGCGGCCAGCTTCAAGAAGAAAGGCTTCCCTGGGTTCTTC
AACTTACCTGACCACGCACTATCGTTGCGCACTTTGTCCTGCCAATCCCCGTCCATGATCAGCTCGAGCTTCTTGGCATTCCACTTTCGCGCCCAGATCG
ATTTCAGCTTGGCGATGACGAACGAATCCGCTGGCTGACAGAGGTCAGTGGAGTTGGGTGGCAAAAAGTGCAGATCCGCATTGAGGATTCGCAGCTCTTC
AGCGCATTCGTCTGCTGACAGGTGCCCTCCACAGTTGTCGAGAAAGATCGCCTTTTTCTTTCCGTGAGGATCGGCACGGATGGCTCGACGTTCGAGCAAA
AACTGACGAAACACACGCTTGTCCATCCACCCTTTCGGTCCGGTGCGGTAACACACGCCTTGAACATCGTCTGGGACGCCTCGTATTGGATAGTTGGCAC
TGGCGTTCTGTAGAATCATCATCGGTGGCATGACACGACCGCTGGCGCCACCGGTAAGTCTGACGACCATCGTCATTCCTTCGCCCCCTGAAACGACTTC
TGCATACTTAATGGAAGTCTCGCCCACGAAGCCAAGCGTTTTTCCGGTGTCGAAGTCGATCACAAAGTGGGTCTCGTCTATGTTTTCGATGGTGTCTTCG
TCTAGGTCGCCACTGAGGAAGCCATGCTGTAGACGACCGAGGTGCCTCGCCACGGATGCTCGGATTTCTTTTGTCTTTCTCCGATACTTGTTTCTTCCCC
GTTTGTGACCTGAGTACAATACCGTGTTTTTCCATAAAATACTGGATCCAAGAGTTTGTCAGCCTCTCGATGATCGTCACGCCTTTGTGGTCGCGGCTTT
GCTTGTTGAACTTGCCAGTTGCCTGTTCGACTGTACGGATTGCA